Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Streptococcaceae

Properties
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1401 celB -83 5.5 TTGCCGTAGTGCTAAGGAAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1282 celR -97 5.3 CTTCACAATCGATACGGAAA
Streptococcus gallolyticus UCN34
GALLO_1217 bglA -87 5.4 TTTCCTAATAACTTAGGAAA
GALLO_1213 celB -93 5.9 TTTCCTTATCAAAGAGGAAA
Streptococcus gordonii str. Challis substr. CH1
SGO_1582 bglA -89 5.9 TTTCCGTTTCGATATGGAAA
SGO_1580 celB -96 6.3 TTTCCGTTTCGATACGGAAA
Streptococcus mutans UA159
SMU.1600 celB -92 5.3 TTCCGTTTTCAATACGGAAA
Streptococcus pneumoniae TIGR4
SP_0305 celB -125 5.7 TTTCCATATCATTTAGGAAA
SP_0303 bglA -86 6.2 TTTCCTTAACAATAAGGAAA
Streptococcus pyogenes M1 GAS
SPy1328 bglA -102 5.8 TTTCCGTGATGATAAGGAAA
SPy1325 celR -100 5.5 TTTCACAATCAATGCGGAAA
Streptococcus suis 05ZYH33
SSU05_2076 celR -100 5.7 TTTCATTAATGATGCGGAAA
SSU05_2079 celF -270 6 TTTCCGTTGTGATACGGAAA
Streptococcus uberis 0140J
SUB0529 celB -141 4.8 TTGCTTTTTTAATAGGGAAA
SUB0529 celB -100 6 TTTCCGCATCATTACGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD