Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CcpN in Lactobacillaceae

Properties
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus casei ATCC 334
LSEI_2334 ppdK -196 4.7 TTTTTAAATATCTCATTGAAA
LSEI_2334 ppdK -66 5 TTCAAAAATAATACATTATAA
Lactobacillus rhamnosus GG
LGG_02351 ppdK -66 4.7 CTGCTAAATAATACATTATAT
Lactobacillus sakei subsp. sakei 23K
LSA1142 ccpN -138 5.4 ATATAGTGTGTCACATTACAA
LSA1141 ppdK -55 5.4 TTGTAATGTGACACACTATAT
Oenococcus oeni PSU-1
OEOE_1329 ccpN -144 4.4 TAATTATGTTTAATAAAAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD