Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CcpN in Streptococcaceae

Properties
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG1672 yqfL -171 5.7 ATATAATATAACATATAAAAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1842 yqfL -174 5.4 ATATAATGTACCATATATAAT
Streptococcus gordonii str. Challis substr. CH1
SGO_0810 ppdK -39 5.7 TTTTAATATAACACATATTAA
SGO_0811 yqfL -216 5.7 TTAATATGTGTTATATTAAAA
Streptococcus sanguinis SK36
SSA_1054 yqfL -124 5.5 TTATAATGTGTTACAAAATGA
SSA_1053 ppdK -142 5.5 TCATTTTGTAACACATTATAA
Streptococcus uberis 0140J
SUB1521 yqfL -44 5.9 ATATAATATACTATATAATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD