Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LACR_0766 in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: LACR_0766 - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_0761 LACR_0761 -35 6.3 AGAGTTTAACGTTAAACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1904 LACR_0766 -232 5.8 TAGGTTTATCGTTAAACTAT
SDEG_1903 LACR_0761 -121 6.3 TCGGTTTAACGATAAACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD