Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdaR in Lactobacillaceae

Properties
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus brevis ATCC 367
LVIS_0411 sdaR -190 4.8 AATTGATCAATGTAACTATG
LVIS_0412 grtP -123 4.8 CATAGTTACATTGATCAATT
Lactobacillus reuteri JCM 1112
LAR_0599 sdaR -338 5 CATAGTTCCTATTATCAAAA
LAR_0600 grtP -172 5 TTTTGATAATAGGAACTATG
Lactobacillus sakei subsp. sakei 23K
LSA0711 grtP -38 4.9 GATTGTGTTATATAACAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD