Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IdnR in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: activator (repressor)
Biological process: Idonate utilization
Effector: L-idonate; 5-dehydro-D-gluconate
Regulog: IdnR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_02793 idnO -39 5.3 TACAGTTACGCGTAACAGCT
Escherichia coli str. K-12 substr. MG1655
b4268 idnK -119 5.9 CTATGTTACGCATAACGTGA
b4267 idnD -117 5.9 TCACGTTATGCGTAACATAG
Salmonella typhimurium LT2
STM4484 idnD -117 5.9 TCACGTTATGCGTAACATTG
STM4485 idnK -119 5.9 CAATGTTACGCATAACGTGA
Serratia proteamaculans 568
Spro_3288 idnO -121 5.1 TCACGTTAAAGGTAACAGCT
Spro_3289 idnR -169 5.1 AGCTGTTACCTTTAACGTGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD