Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelQ in Streptococcaceae

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelQ - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1430 Sez_1430 -84 6.6 TTTGTTTATAAAAAGTAAACAAA
Sez_1430 Sez_1430 -38 5.9 TTTGTTAATATTTTTAAAATAAA
Sez_1431 celQ -164 5.9 TTTATTTTAAAAATATTAACAAA
Sez_1431 celQ -118 6.6 TTTGTTTACTTTTTATAAACAAA
Streptococcus pneumoniae TIGR4
SP_0474 celB2 -35 6.4 TTAATTTATAAAAAATAAAAAAA
SP_0473 celQ -155 6.4 TTTTTTTATTTTTTATAAATTAA
Streptococcus sanguinis SK36
SSA_0268 celD2 -71 6.5 TTTGTTTATATATTGAAAATAAA
SSA_0267 celQ -156 6.5 TTTATTTTCAATATATAAACAAA
Streptococcus suis 05ZYH33
SSU05_0212 celB2 -45 6.6 TTTAATTAAAATTTATAAATAAA
SSU05_0211 celQ -125 6.6 TTTATTTATAAATTTTAATTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD