Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LJ1265 in Lactobacillaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Pentose utilization
Effector:
Regulog: LJ1265 - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA1488 LJ1265 -103 6.4 ACTTGTAATTGCTTACAAAA
LBA1489 LJ1266 -46 6.4 TTTTGTAAGCAATTACAAGT
Lactobacillus johnsonii NCC 533
LJ1265 LJ1265 -108 6.6 TCTTGTAAATGCTTACAAAA
LJ1266 LJ1266 -45 6.6 TTTTGTAAGCATTTACAAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD