Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ScrR2 in Lactobacillaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR2 - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0287 scrR2 -130 6.5 TTTTGGAACCGTTTCCATTT
LEUM_0288 scrA2 -49 6.5 AAATGGAAACGGTTCCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD