Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LSEI_0368 in Lactobacillaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: LSEI_0368 - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus casei ATCC 334
LSEI_0368 LSEI_0368 -71 6.5 TTGTGTAAACGTTTTCGCAT
LSEI_0368 LSEI_0368 -169 6.7 TTGCGGTAACGTTTACGCAA
LSEI_0367 tal -44 6.7 TTGCGTAAACGTTACCGCAA
LSEI_0367 tal -142 6.5 ATGCGAAAACGTTTACACAA
Lactobacillus rhamnosus GG
LGG_00419 LSEI_0368 -82 6.5 TTGTGTAAACGTTTTCGCAC
LGG_00419 LSEI_0368 -180 6.7 TTGCGGTAACGTTTACGCAA
LGG_00418 tal -141 6.5 GTGCGAAAACGTTTACACAA
LGG_00418 tal -43 6.7 TTGCGTAAACGTTACCGCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD