Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AlsR in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Allose utilization
Effector: Allose-6-phosphate
Regulog: AlsR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1639 alsE -31 6.5 TTGGGTAATCGTTATCTCAA
LACR_1640 alsR -182 6.5 TTGAGATAACGATTACCCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD