Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BfrR in Lactobacillaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA0502 bfrE -28 6.4 AAATTGAAACGTTTCAAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD