Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BfrR in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus gordonii str. Challis substr. CH1
SGO_1305 bfrE -88 6.5 AAAATGAAACGTTTCAAAAA
SGO_1305 bfrE -30 6.5 AAAATGAAACGTTTCAAAAA
Streptococcus pneumoniae TIGR4
SP_1798 bfrF -93 6.5 AAAATGAAACGTTTCAAAAA
SP_1798 bfrF -31 6.5 AAAATGAAACGTTTCAAAAA
Streptococcus suis 05ZYH33
SSU05_1341 bfrR -33 6.1 TTATTGAAACGTTTCACAAG
Streptococcus uberis 0140J
SUB0304 bfrF -31 6.5 AAAATGAAACGTTTCAAAAA
SUB0304 bfrF -85 6.5 AAAATGAAACGTTTCAAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD