Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FucR in Enterobacteriales

Properties
Regulator family: DeoR
Regulation mode: activator
Biological process: Fucose utilization
Effector: L-fuculose-1-phosphate
Regulog: FucR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Citrobacter koseri ATCC BAA-895
CKO_04159 fucA -225 6 ATGCCCGTTTGGATAAATAATATTAAGAGCGGTCAT
CKO_04160 fucP -310 7.6 ATGCCCGTTTTCGCAGTAATAAATTAAATCGGTCAT
CKO_04159 fucA -281 7.6 ATGACCGATTTAATTTATTACTGCGAAAACGGGCAT
CKO_04160 fucP -366 6 ATGACCGCTCTTAATATTATTTATCCAAACGGGCAT
CKO_01448 aldA -218 6.4 TTGCCCGTTTGCGGAAATTTACGCTCAAACGGGCAA
Edwardsiella tarda EIB202
ETAE_0293 fucA -312 6.8 ATGACCGAATAGGCATTTTTTATTTTAAACGGTCAA
Escherichia coli str. K-12 substr. MG1655
b2800 fucA -284 7.3 ATGACCGTATTAATTGTTTGTGCCGAAAACGGTCAT
b2800 fucA -225 6.3 ATGACCGTTTTGATAAATATTTTTAAGAGCGGTCAT
b2801 fucP -357 6.3 ATGACCGCTCTTAAAAATATTTATCAAAACGGTCAT
b2801 fucP -298 7.3 ATGACCGTTTTCGGCACAAACAATTAATACGGTCAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03152 fucP -351 7 TTGCCCGTTTTCCACGATATATATTCATTCGGTCAT
KPN_03151 fucA -290 7 ATGACCGAATGAATATATATCGTGGAAAACGGGCAA
KPN_03151 fucA -236 5.6 ATGCCCGCTTGATGAAATATTATTAAGAACGGGCAT
KPN_01501 aldA -218 6.2 ATGCCCGTTTACGGCAGATTCGTCGCAAACGGGCAA
Salmonella typhimurium LT2
STM2974 fucA -293 7.1 ATGCCCGAATTAAATTATTGCCACGAAAACGGGCAG
STM2974 fucA -237 6.2 TTGCCCGTTTTAAAAAATATTATTAAGAGCGGGCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD