Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cagg_1084 in Chloroflexia

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog: Cagg_1084 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_1085 COG0730 -81 7.4 ATACATCAGATGATCTGATGTTT
Cagg_1084 Cagg_1084 -36 7.3 AAACATCAGATGATATGATCTTT
Chloroflexus sp. Y-400-fl
Chy400_3103 Cagg_1084 -37 7.3 AAACATCAGATGATATGATCTTT
Chy400_3102 COG0730 -41 6.9 AAACATCAGATCATCAGATGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD