Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HcpR in Chloroflexia

Properties
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: HcpR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus aggregans DSM 9485
Cagg_2669 Rcas_3898 -86 6.8 AAGTTGCGCTAGCGCAACGT
Cagg_2026 Rcas_3898 -116 6.5 ATCTTGCGCTAGCGCAACGA
Roseiflexus castenholzii DSM 13941
Rcas_3898 Rcas_3898 -111 6.5 AACTTGCGCCAGCGCAACGA
Roseiflexus sp. RS-1
RoseRS_0596 Rcas_3898 -105 6.5 AACTTGCGCCAGCGCAACGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD