Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur2 in Chloroflexia

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur2 - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Roseiflexus castenholzii DSM 13941
Rcas_3900 Rcas_3900 -157 5.6 CAACTGATAGATAAGATCATTTG
Rcas_3894 COG0701 -33 7 TAAGTGATAGTAACTATCATTTA
Rcas_2945 yciC -59 5.6 TCATTGATATACACTATCATCAA
Rcas_2948 fmdB -50 6.1 CAAGTGATAGCATATATCACAAA
Rcas_3893 Rcas_3893 -63 5 TCGTTGAAAGTAACTATCATCTG
Roseiflexus sp. RS-1
RoseRS_0598 Rcas_3900 -159 5.5 CAAATGATAGACGAGATCATTTG
RoseRS_3105 yciC -40 5.9 GAACTGATATGATCTATCATTTG
RoseRS_0845 Rcas_3893 -61 5.8 AAAATGGTAGTTGCTATCATTGA
RoseRS_3107 fmdB -3 6 TAAGTGATAGCATATATCACACT
RoseRS_0592 COG0701 -33 6.5 ACAATGATATTTACTATCATTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD