Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HomR in Streptococcaceae

Properties
Regulator family: LysR
Regulation mode: activator
Biological process: Methionine metabolism; Cysteine metabolism
Effector: O-acetyl-L-serine
Regulog: HomR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_0831 metB2 -80 4.8 GACATAGCATTTTCTTATGGC
Lactococcus lactis subsp. lactis Il1403
L0100 metE -99 4.3 CATATAGTTTAAAACTATAGG
L0181 metB2 -79 6 GCTATAAAAAAATCTTATAGC
Streptococcus gallolyticus UCN34
GALLO_1768 metB -142 5.9 GTTATAGTTTTTACTTATAGC
GALLO_1277 GALLO_1277 -113 5.7 GTTATAAAAAAATCTTATCAC
GALLO_1275 tcyD -104 5.6 GCTATAAGCAAATCTTATGGC
GALLO_1316 metE -172 5.2 GTTATAGTTAAAAACTATAAT
Streptococcus gordonii str. Challis substr. CH1
SGO_0310 metE -99 4.6 GATATAGTTTTTGGCTATATC
SGO_0310 metE -182 5.2 GTTATAGTTTTTGATTATACC
Streptococcus mitis B6
smi_1600 metE -101 4.8 GATATAGTTTCAAACTATATC
Streptococcus mutans UA159
SMU.930c GALLO_1277 -110 5.2 GCCATAAGAAAAAGTTATCAC
SMU.932 tcyD -168 5.2 GTGATAACTTTTTCTTATGGC
SMU.932 tcyD -103 6.1 GTCATAAATAAAATTTATAGC
SMU.1675 metB -110 4.9 CTTATAGTTTCTTTTTATAGC
SMU.930c GALLO_1277 -175 6.1 GCTATAAATTTTATTTATGAC
SMU.873 metE -188 5.4 GTTATAGATGAAAACTATAAC
Streptococcus pneumoniae TIGR4
SP_0585 metE -218 5 CTTATAAGAATTACTAATAAC
SP_0585 metE -251 5 GTTATAGTCTTTTCTAATAAC
Streptococcus sanguinis SK36
SSA_0416 metE -182 5.3 GTCATAATTTCTACCTATAGC
SSA_0416 metE -99 5.2 GTTATAGTTTTAGACTATATC
Streptococcus suis 05ZYH33
SSU05_1774 metE -237 4.7 TTCATAGATAAAATCTATACC
SSU05_1774 metE -101 4.8 GTTATAGTCAAAAGTTATACC
Streptococcus thermophilus CNRZ1066
str0352 metB -132 5.4 GTTATAGTAATAAACTATATC
str0785 metE -60 4.6 GATATAGTTTAAAACTATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD