Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Burkholderia

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL3360 gcvT -233 29.8 TTTCGCACTCTGGAGAGCGGCAGTAGCCGCGTGCGCGCAACGCGACGCACGGGCAGGCTGCCCACCGAAGGGGCGCGCGCGAGCCGGATCGAAACCGTCGCGCAATCTCTCAGGTATCGAGGACAGAGGGGCATGCAC
BPSL3360 gcvT -375 37.5 CGCACGCGTCGGGAGAGCGCGCGGCCGCCGTTCGTTGATCGAAAGGCAAGCCGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGAAG
Burkholderia mallei ATCC 23344
BMA2994.1 gcvT -377 37.5 TCCGCACGCGTCGGGAGAGCGCGCGGCCGCCGTTCGTTGATCGAAAGGCAAGCCGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGA
BMA2994.1 gcvT -235 29.8 TTTTTCGCACTCTGGAGAGCGGCAGTAGCCGCGTGCGCGCAACGCGACGCACGGGCAGGCTGCCCACCGAAGGGGCGCGCGCGAGCCGGATCGAAACCGTCGCGCAATCTCTCAGGTATCGAGGACAGAGGGGCATGC
Burkholderia sp. 383
Bcep18194_A3325 gcvT -356 41.7 CCCGCACGCGTCGGGAGAGCGTGTAACCAGGCTGTTTCAGCACCGGTTGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGG
Burkholderia cepacia AMMD
Bamb_0133 gcvT -355 35.1 CCCGCACGCGTCGGGAGAGCGTGTGACCGCGTAGCTAGGAACGCCGGTCGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGG
Bamb_0133 gcvT -219 29.6 CTCCCCGCACTCTGGAGAGCGGCAGTAGCCCATTGCGCCCATGCGGCGCGGGCAAGCTGCCCACCGAAGGGGCGCGCGTTCGCAGGCTCACGGCCGCAGCGCAATCTCTCAGGTATCGAGGACAGAGGGGCATGG
Burkholderia vietnamiensis G4
Bcep1808_0151 gcvT -355 38.5 CCCGCACGCGTCGGGAGAGCGCGTGACCGCATAGTCGATACGCCGGTCGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGG
Bcep1808_6673 dadA -143 44.7 ATCTGGAGAGAGGCGCATTGCGCGCACACCGAAGGGGATTTCCTGCACAGGCTGCAGGAGAGAAACTCTCAGGTACATGGACAGATGGG
Bcep1808_6673 dadA -242 68.6 GAAACAACACGGGAGAGACTGTCATCCGAATTGGAGTGACAGCGCCGACGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGTGGTGTCAGAAC
Burkholderia glumae BGR1
bglu_1g01030 gcvT -216 30.4 GAGTTCGGACTCTGGAGAGCGGCAGTAGCCACGTGCATCGGCAGGCTGCCCACCGAAGGGGCGCGCGCGGGCCGGTCACGGCGGCGCAATCTCTCAGGTATCGAGGACAGAGGGGCTGTC
bglu_1g01030 gcvT -352 43.3 CCGGCACGCGTCGGGAGAGCGCGCGACGGTTTGTCACCAAGCCAGTTGCGCCGCCGAAGGGGCACACCCACAAACTCTCAGGCAAAAGGACCGAACGCGTCGGA
Burkholderia xenovorans LB400
Bxe_C0404 dadA -139 50.9 CAGGACAATCTGGAGAGAGGCGCGAGGCGCCCACCGAAGGGGAAACCGGCTCATGCACGCCGCCGGTCAAGCTCTCAGGTACCCGTACAGATGGGGTGTCAC
Bxe_B1348 dadA -276 62.9 AATGCAGCGCGGGAGAGATCGTCAGATGTTCGTGACGACGCCGACGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGTGCAGCAGGAAC
Bxe_B1348 dadA -181 35.1 ATCTGGAGAGCGGCGCATCGGCACAGCTTGTGCGCCCACCGAAGGGGATTCCCCGCACACGGCTCGCATCGGGCCGGCCGCCGCGGAGAAGAAACTCTCAGGTACATGGACAGATGGG
Bxe_C0404 dadA -228 48.8 TGAATCGCGCGGAAGAGCCCAGCATCCCGGATGCTGGCGCCGACGGAGCAACCGCCCCGGAAACTCTCAGGCAACCAGGACCGCGCGATC
Bxe_A0056 gcvT -195 37.8 TTTCGCACTCTGGAGAGCGGCAGTAGCCGTCTGCATCGTTCAATCGAGCAGATTGGCAGGCTGCCCACCGAAGGGGCGCGCGTTTCACCGTGGCGGACTCACGTTCTCACGGCAACGCAATCTCTCAGGTATCGAGGACAGAGGGGCCATGCA
Bxe_A0056 gcvT -330 38.7 CGTACGCGTCGGGAGAGCGTGCTGGCCGCAGAAAACCGTAGGCCGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGACCGCGTCGAAA
Burkholderia phymatum STM815
Bphy_3003 gcvT -221 33.1 TTTCGCACTCTGGAGAGCGGCAGTAGCGCCCGTGCAGAATGCGCGCGCAAGCTGCCCACCGAAGGGGCGCGCGCCACGCCAGCCAGCACTCGCTGACGGCAGCGCAATCTCTCAGGTATCGAGGACAGAGGGGGCATGCA
Bphy_3003 gcvT -380 44.3 CGCACGCGTCGGGAGAGCGCGCCGTTTGCTGTCGTCCGTAGTCACAGCATGCAGCGCCGCCGAAGGGGCACACCCGCAAACTCTCAGGCAAAAGGACCGAACGCGTCGAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD