Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Burkholderia

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL1759 cobG -309 68.1 TACAGCGTCCGTCGACCGGCGCCCCACGGGGCCCAAGAGGGAACGCAGGGCGCGCCGCGCCGCTGCGGCTGCCCCCGCAACTGTGAGCAGCGAGTCCGCATCCGATTCACGCCACTGGCCACGCCGCCCTTTCGCGGCCGCCGGGAAGGCCCGCTGCGGACGACGACCTGCCAGCCAGGAGACCTGCCGGGACGTTTCGTTCGTGCAA
BPSL1770 hoxN -586 37.8 CGTTTCGGTGCTCGCGCGCGGTTTCTGTCGCGCGCAGTCAAACGGGAAACAGGGAGCGTCGCCGCGTCGCGGCCCGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGAAGGCATCGCGCGAGCGGTGCGACGCCGGCTTCTCCGCGCGCCTGACGGCTTGCGCGGCCAACCACTGGACGCATCGCGTCCGGGAAGGTGAAGCGGCGTTTTCGTCAGCCCGGATACCGGCCGAGACACGGGGCCCGTTC
BPSL0976 btuB -335 17.7 TAAACTGGCGCCGCCTCGGTGCTCGCGCGCTTCGCGCGCGGTTAAACGGGAAGCAGGGCGCGACGTCCGCCAGGGCCGAGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGATCGCATCGGAGCCGATCCGATGCCAGCCGCACTCTCGA
Burkholderia mallei ATCC 23344
BMA1161 cobG -309 58.2 TACAGCGTCCGTCGACCGGCGCCCCACGGGGCCCAAGAGGGAACGCAGGGCGCGCCGCGCCGCTGCGGCCGCCCCCGCAACTGTGAGCAGCGAGTCCGCATCCGATCCACGCCACTGGCCACGCCGCCCTTTCGCGGCCGCCGGGAAGGCCCGCTGCGGACGACGACCTGCCAGCCAGGAGACCTGCCGGGACGTTTCGTTCGTGCAA
BMA1172 hoxN -571 37.8 CGTTTCGGTGCTCGCGCGCGGTTTCTGTCGCGCGCAGTCAAACGGGAAACAGGGAGCGTCGCCGCGTCGCGGCCCGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGAAGGCATCGCGCGAGCGGTGCGACGCCGGCTTCTCCGCGCGCCTGACGGCTTGCGCGGCCAACCACTGGACGCATCGCGTCCGGGAAGGTGAAGCGGCGTTTTCGTCAGCCCGGATACCGGCCGAGACACGGGGCCCGTTC
BMA0685 btuB -336 17.7 TAAACTGGCGCCGCCTCGGTGCTCGCGCGCTTCGCGCGCGGTTAAACGGGAAGCAGGGCGCGACGTCCGCCAGGGCCGAGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGATCGCATCGGAGCCGATCCGATGCCAGCCGCACTCTCGA
Burkholderia sp. 383
Bcep18194_A4824 cobG -227 89.3 CTACGGCCGTTCGTTCGCCGGTGCCCCTCGGGGCCGAAGAGGGAACACAGGGCGCGCCACGCGCCGCTGTGGCTGCCCCCGCAACTGTAGACAGCGAGCCGATCTCCCCCTCATGCCACTGGTTCCACCGGGAAGGCCGGGAGCCGGCGCCGACCTGTCAGCCAGGAGACCTGCCGGCCTGAAAGTGCGTGCG
Bcep18194_A4802 cysG -408 35.8 TATCGTATGCGCCGCGTTCGGTGCTCGCATGCGCATTCCGCGCCTGCAGTTAAACGGGAAACAGGAGGCGGACCACCGCCCGGCCTGTGCTGTCCCCGCAACGGTACGCCGCCCGCGCGATGCGCTTCCCCGCGCACGCGCCCATGCCGCCCACGATGCCACTGCCCTTCAGCCGGGCGGGAAGGCTGCGGCCTGGCAAGCGGCCAGCCCGGATACCGGCCGACGCAAGGGGCGAGCCC
Bcep18194_B1485 btuB1 -254 115.1 ATTACCCTTGCGCGCTGATGGTTCCCGGAAACGGGATCAAAAGGGAACGCAGGAGAGGCAGCGCCTCGAATCTGCGGCTGCCCCCGCAACTGTGAGCGGCGAATCCGTGCCACTGCATGCCACTGGGAAACCGGGAAGGCCGGCACGAATCAGGACCCGCGAGCCAGGAGACCTGCCATCGACCCGAGGTCCAAG
Bcep18194_B0359 bglu_2g19320 -174 45 CCGCTTCAATACGCGAACGTTCGCGCGTACAATTCGCCCGATACGAAACGCGGAAGCCGGTTCAATTCCGGCGCGGTCGCGCCACTGTAACCGGTGATCCATGATCCCGGAAGCCAGACCTGCCTTCGTACCCATCCAACATTT
Bcep18194_A4805 cobW -595 42.1 ACACTCGCACGCGTTTTGGTGCTCGCGCGCGCCGCTCCGGTGCGCGCAGTTAAACGGGAAACAGGGAGCCTGCCTGCGCCGCAGTCGAGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGAACGCGTCGCGCCCATGCGCGTCGCAACGCCGCTTCGCCGCATGCCGCGCGCATGCGGACGACCGCCACTGGATGCTGTGCGCATCCGGGAAGGCGAAGCGGCGTGTTCGTCAGCCCGGATACCGGCCTAAACATTGGGGTTCAGCGC
Bcep18194_A5786 btuC -411 15.9 CCTAAACTGGCGCCGCCTCGGTGCTCGCGCGTGGAACGCGCGGTTAAACGGGAAGCAGGGCGCGGGCGCCGGAAGCCCGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGGCCGCGTCCGATGACGCAGGCCGGCTCGGGCGCGTTTCAC
Burkholderia cepacia AMMD
Bamb_1574 cobG -299 95.1 CTACGGCCGTTCGTTCGCCGGTGCCCTTCGGGGCCGAAGAGGGAACACAGGGCGCGTATCGCGCTGCTGTGGCTGCCCCCGCAACTGTAGACAGCGAGCCGATCTCCCCCCTCATGCCACTGGTTTCACCGGGAAGGCCGGGAGCCGGCGCCGACCTGTCAGCCAGGAGACCTGCCGGCCTGAAAGTGCGTGCG
Bamb_1554 cysG -272 33.8 TATCGTATGCGCCGCGTTCGGTGCTCGCGCGCGCTCCTCCGGCGTGCGCAGTTAAACGGGAAACAGGAGGCGGACGTCCGCCCGGCCTGTGCTGTCCCCGCAACGGTACGCCGCCCGCGCGTCGCGGTTCCCCGCACGCGCCCAGGCCGCCCGCGATGCCACTGCCCTTCAGCGGGCGGGAAGGCTGCGGCCTGGCAAGCGGCCAGCCCGGATACCGGCCGACGCAAGGGGCGAGCCC
Bamb_3886 btuB1 -402 113.2 TACGCTTGCGCGCTGATGGTTCCCGGGAACGGGATCAAAAGGGAACGCAGGAGAGGCAGCGCCTCGAATCTGCGGCTGCCCCCGCAACTGTAAGCGGCGAATCCGCGCCACCACACGCCACTGGGAAACCGGGAAGGCCGGCGCGAATAACGACCCGCGAGCCAGGAGACCTGCCATCGACCCGAGGTCCAAGCA
Bamb_4649 bglu_2g19320 -177 37.2 CGGGCCTTCAACACGCGAACGTTCGCGCGTACAATTCGCCCGATACGAGGTGCGGAAGCCGGTGCAAGCCCGGCGCGGTCGCGCCACTGTAACCGCGGATCTTCAATCCCGGAAGCCAGACCTGCCTTCGTATTCCATCCAACA
Bamb_1556 cobW -595 37 ACACTCGCACGCGTTTTGGTGCTCGCGCGCGCTCCTCCGGCGCGCGCAGTTAAACGGGAAACAGGGAGCCTGCCTGCGCCGCAGTCGAGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGAACGCGTCGCGCCCAGCGCGACGCAGCGCCGCTTCGCCGCATGCCTGCCGCATGCGGACGACCGCCACTGGATGCCGCGCATTCGGGAAGGCGAAGCGGCGTGTTCGTCAGCCCGGATACCGGCCGAAACGTTGGGGTTCAGCGC
Burkholderia vietnamiensis G4
Bcep1808_1610 cobG -296 86.9 CTACGGCCGTTCGTTCGCCGGTGCCCTTCGGGGCCGAAGAGGGAACACAGGGCGCGCCGCGCCGCTGTGGCTGCCCCCGCAACTGTAGACAGCGAGCCGCGCTCCGCCACATGCCACTGGTTTCACCGGGAAGGCCGGGAGCCGGCGCCGACCTGTCAGCCAGGAGACCTGCCGGCCAGAAAGTGCGTGCG
Bcep1808_1599 cysG -399 37.6 TATCGTATGCGCCGCGTTCGGTGCTCGCGTGCGCATTGCGCGCATGCAGTTAAACGGGAAACAGGAGGCGGAGCTTCGCCTGGCCTGTGCTGTCCCCGCAACGGTACGCCGCCCGCGCGCCGCGGTTGCTCCGCGCGCGCCCAGGCCGCCCTCGATGCCACTGCCCCAGCGGGCGGGAAGGCTGCGGCCCGGCAAGCGGCCAGCCCGGATACCGGCCGACGCAAGGGGCGAGCGC
Bcep1808_5001 btuB1 -402 107.9 TACGCTTGCGCACCGATGGTTCCCGGAGACGGGATCAAAAGGGAACGCAGCAGAGGCCGAGCCTCCAATCTGCGGCTGCCCCCGCAACTGTAAGCGGCGAATCCGCGCCACCACGCGCCACTGGGAAACCGGGAAGGCCGGCGCGGATGACGACCCGCAAGCCAGGAGACCTGCCATCGACCCGAGGTCCAGCAG
Bcep1808_2539 btuC -736 29.8 CCTAAACTGGCGCGGCCTCGGTGCTCGCGCGTGCGTCGCGCGGTTAAACGGGAAGCAGGGCGTGCGCTTCGCCAGGAGCTCGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGGCCGCGTCGTACGACGCAGGCCGGCTCGGGCGCGTTTCGCATGCAGCTTGCGCATGCGGGCGCGGGCCACTGCGCGCGATGCGCGCGGGAAGGCGAGCCGGCACGCCGTCAGCCCGGATACCGGCCGAGACGAGGAGCCCGTCG
Bcep1808_1600 hoxN -449 39.2 ACACTCGCACGCGTTTTGGTGCTCGCGCGCGCTGCTCCGGCGCGCGCAGTTAAACGGGAAACAGGGAGCCTGCCTGCACCGCAGACGAGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGAACGCACGCGCCCAGCGCGTTGCAGCGCCGCTTCGCCGCATGCCCAGCGCATGCGGACGACCGCCACTGGATGCCGCGCATCCGGGAAGGCGAAGCGGCGTGTTCGTCAGCCCGGATACCGGCCAGAACGTGGGGTTCAGCGCC
Burkholderia glumae BGR1
bglu_1g18430 cobG -422 25.5 ATACAGCCTCGTTCGCCGGTGCCCAACGGGCCTAACAGGGAACGCAGGGCGTGGCTCGCCGCGCCGCTGCGGCTGCCCCCGCCACCGCGTGCAGCGAGTGCGCCGCCCGTCGATGCCGCGGGATGCATGCCGGAAGACGCGCGGCGGCGAGCTGCGCGCCAGCAGACCTGCCGGCCCGATGAGCGTGCCGGC
bglu_1g18540 cbiG -316 18.1 ATCGACGAACGCCACTGCCGCACGCGGCGGGAAGGCCTCGATCCG
bglu_2g14800 btuB2 -459 33.8 CGGAAGCGGGTGAAAATCCCGCGCGGTCGCGCCACTGTGACCGGTTTCGCCGTCGTCCGACGGCGGTGCCGGAAGTCAGAC
bglu_2g19320 bglu_2g19320 -142 31.1 AGCCGGTGTGAATCCGGCGCGGTCGCGCCACTGTCAGCGAGGCATTCGCTTGTCCCGCAAGCCAG
bglu_1g18530 cobW -435 28.5 CTACACTCGCAGCCGTTTTGGTGCTCGCGTGCGGATTCCTGCGCACGCAGTTGAACGGGAAACAGGGCATCGGGCCGCGCCGCGGCCGCGATCAACCTGTGCTGCCCCCGCAACGGTAAGCGACTGCATCGCAAAGAGGCGATGCGAGGCCCGCTTCACCGCGCGTGCGCGTCACGCGCGGCCAGGCCACTGGATGCCGCCGGCGTCCGGGAAGGCGAAGCGGCGCGGTCGCCAGCCCGGATACCGGCCAGAACGGCGGAACCGCCG
bglu_1g28210 btuB -344 17.3 CTTCGGTGCATGCGTGCGAGACCTTGTCGCACGCAGTTAAACGGGAAGCAGGAAGCCGCCGATCCGGACGAGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGACCGCGTCGATCGCGCATCGATCACGACGC
Burkholderia xenovorans LB400
Bxe_B1245 cobG -205 111.1 GGCATAATACAGCCGCCGGTTGCCCTTCGGGGCCGAAGAGGGAACACAGTGCCACTGTGGCTGCCCCCGCAACTGTATGCAGCGAGTCCGCCTGCGCTTCACGCCACTGGTTCGACCGGGAAGGCCGCAGCGGACCATGACCTGCCAGCCAGGAGACCTGCCGGCGAGACTGTTCGTGCCAG
Bxe_B1649 cysG -465 48.1 CTATCGTAGGCGCGCGTTTGGTGCCCGCACATGCATTCGCGTGTGCAGTTAAACGGGAAACAGGCCGCGCTTCACGCGCTCAACCTGTGCTGTCCCCGCAACGGTAAGCGACCTGCGGAGCAATGTTGAGTTGTCTTGCGCCGCGCATGCGTTTTTTCGATGCCACTGTCCTGCGCATTCCAGCGAATGCGGACGGGAAGGCAAAGCGCATGAGGCCGCCAGCCCGGATATCGGCCAGACGCGGAGGCGGCGCA
Bxe_B2601 bglu_2g19320 -134 32.9 GAAGCCGGTGAAAGCCCGGCGCGGTCGCGCCACTGTAATCGGCAGCCCAAGCCGAAAGCCAGACCT
Bxe_B1647 cobW -462 51.8 ACACTCGCACGCACTTTGGTGCTCGCGTGCCCGCTCGTGCGCATGCAGTTAAACGGGAAACAGGGTGCCCGCCTGTCATGGATCGGGTCAACCTGTGCTGCCCCCGCAACGGTAAGCGAAATGTGGTGCTAAGGTCAGTTCTTTAGCGCCGCGGAGCCGGCTTCGATGTCCACGCGCAAGGCCGCGCGGGCATGTCACCACTGGGCGAGAAATCACTCGCCCGGGAAGGGGAAGCGGCGCTTTCGCCAGCCCGGATACCGGCCAGATACGAAGAATGAACACC
Bxe_A3502 btuB -346 58.5 TACACTGGCCGCACTCTGGTGCCCGCGTGCGCTTTTCAACGGCGCGCGCAGTTAAACGGGAAGCAGGGGGCGCGGTTCGCCAGAACGCGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGACCGCATTCGTCTGCAAGTCGATCCTGACCGCGTGTTGAAAGTTCAACTCGCGAGTGTGCCACTGCGCGTCACGCGTGGGAAGGCGGGATCGAGAGGTCGCCAGCCCGGATACCGGCCAGAGGGAGAGGCACGTCACG
Burkholderia phymatum STM815
Bphy_3154 cysG -444 56.1 ATCGTATGCGCGCGTCTGGTGCCGTGCCTGGGTTCGCTTGCACGGTTAAACGGGAAACAGGGAAGCGCCTCATTTGCACGGCACGCGTCGTGCGGCGAACGAAGCGCTCAGCCTGTGCTGTCCCCGCAACGGTCACGCGGCGAGTGGAAGAGCAACTTCCGCGCAGTGCGTTCAAGGCCACTGCCTGCATCATGCGGGTGGGAAGGCGAGCGCGATGAGCCGCCAGCCCGGATACCGGCCAGATGCAAGGGGGCGACGAG
Bphy_3143 cobG -266 40.2 CATAATACCCGTTCGCCGGTGCCTTTCGGGGCCTAAGAGGGAACACGCATCATGGCGATGACCGTGACTACCCCCGCAACTGTATGCAGCGAGGCTAGCGCTTTTCATGGACCACAGCAGGCGTTATAGCGCTAGCTCTGGTCGACAGCTCATAAAACCTGCCGGCTAATAGTTCGTGCCAGC
Bphy_3437 bglu_2g19320 -191 34.9 GCAGTTTAGCGCGTAGAATAGTCGCCACTCGAAGCGCGGAAGCCGGTGCAAGCCCGGCGCGGTCGCGCCACTGTAATCGGCAGTACATGCGTACACCAACATGCGGTACACAAGCCGGAAGCCAGACCCAAGCTTCGACTTCCCTTATCAAT
Bphy_2213 btuB -319 41.5 TCTACACTTGCGGCACTTTGGTGCCCGCGCGCGGTATCGTCCCGCGCGCAGTTAAACGGGAAGCAGGAAGCGAGTCCGCCCGGATGAGCCAACCTGCGCTGTCCTCGCAACGGTACAACGATGCATGTCGATCCATCGCAATCGTCGAGCCGATCATCGGCCGATGCCGTGCGACGAACGCCACTGCGCATGACGCGTGGGAAGGCGGGTCGGCCAGTCGCCAGCCCGGATACCGGCCAGAGTCGGAGCGCATGAC
Bphy_3153 cobW -466 30.5 CTAAACTCGCACGCACTCTGGTGCTCGCGCGCGCTTTCTGCTCGCGCAGTTAAACGGGAAATAGCAGGCCCCTCGTGTTGTCTCGAGTCGTCACAGGGCCAAGCTGTGCTGCTCCCCGCAACGGTAGGTGAAGGCATCGCGAAGTCGATGCGGAGCCGTCTCGCTGCATGTGTGTCCAACAGCGGCCCATGCAGATCATCCACTGCGCGAAAACGCTCGCGCGGGAAGGAGAGGCGGCGCTTTCATCAGCCCGGATACCGGCCCGAGAAAACGACGCAACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD