Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Burkholderia

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL0678 ribB -290 95.6 TGCGTCTTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAGGCCGGCATGTTGCCGGCGAGCCCGCGAGCGCCCGCGCGATTGCGCGCGGGGTCAGCAGATCTGGTCCGATGCCAGAGCCGACGGTCATAGTCCGGATGAAAGAAGATGTGCAG
Burkholderia mallei ATCC 23344
BMA0230 ribB -290 94 TGCGTCTTCAGGGCGGGGCGAAAATCCCCACCGGCGGTAGGCCGGCATGTTGCCGGCGAGCCCGCGAGCGCCCGCGCGATTGCGCGCGGGGTCAGCAGATCTGGTCCGATGCCAGAGCCGACGGTCATAGTCCGGATGAAAGAAGATGTGCAG
Burkholderia sp. 383
Bcep18194_B1525 ribH -222 103.9 AACGTTCTCGGGGCGGGGTGAAATTCCCCACCGGCGGTAATCGCGCGATTGCGCGTAGCCCGCGAGCGCTTGCCGGCACGCATGTGCCCGGCAAGGTCAGCAGACCCGGTTGGATTCCGGGGCCGACGGTCAAAGTCCGGATGAGAGAGAGCGGGGTT
Bcep18194_A6016 ribB -268 97.4 AGTGCGTCTTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAGGCTGGCGTAAGCCGGCGAGCCCGCGAGCGCCCGCGCATCCGCGCGGGGTCAGCAGATCTGGTCGAATGCCAGAGCCGACGGTCATAGTCCGGATGAGAGAAGATGTGC
Burkholderia cepacia AMMD
Bamb_2742 ribB -268 97 AGTGCGTCTTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAGGCTGGCGAAAGCCGGCGAGCCCGCGAGCGCCCGCGCAACCGCGCGGGGTCAGCAGATCTGGTCGAATGCCAGAGCCGACGGTCATAGTCCGGATGAGAGAAGATGTGC
Burkholderia vietnamiensis G4
Bcep1808_2793 ribB -268 97.2 AGTGCGTCTTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAGGCTGGCGAAAGCCGGCGAGCCCGCGAGCGCCCGCGCAGCTGCGCGGGGTCAGCAGATCTGGTCGAATGCCAGAGCCGACGGTCATAGTCCGGATGAGAGAAGATGTGC
Burkholderia glumae BGR1
bglu_2g11360 ribH -229 97.8 CGAACGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAATCATGCTCCGCGCATGTAGCCCGCGAACAGCTCGCCTCGGGTGCGCCCGACGCGATGCCTGCCGACCCGGTGCGATTCCGGGGCCGACGGTCATAGTCCGGATGAGAGAGAGCGGGG
Burkholderia xenovorans LB400
Bxe_A0635 ribB -270 46.8 TTTGCATGGGACCGGAGTAATGCGCCAAAGCGCGAACTCCGGCCAACGGCTAAAGCGCCAACTCTGGTCGACATGGGGTCAGCAGATCTGGTGAGAAGCCAGAGCCGACGGTTAGAGTCCGGATGGAAGAAGATGTGC
Burkholderia phymatum STM815
Bphy_0417 ribB -390 99.6 TACGTCTTCAGGGCGGGGTGAAATTCCCCACCGGCGGTATGCAGGCGGGGCGCATCATCGCGTGCGAGTCTGCGAGCCCGCGAGCGCCTGCGTTGCAGTTCGGGATGCAGGGTCAGCAGATCTGGTGAGAGGCCAGAGCCGACGGTTAGAGTCCGGATGGAAGAAGATGTGCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD