Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Caulobacterales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC0482 metE -345 98.6 TCTGTTGCCGTTGTCGTGGTCTGCGGACGTTCGCGTCCGGAGCTAAGAGGGAAGTCGGTGAGGGCGTGAAACCCTGAATCCGGCGCTGCCCCCGCAACTGTGAGCGGCGAGCCGCTGTCCGTTTCGTGTCACTGACGCGCCGAAGCTGGTTCGGGGATGCGTCGGGAAGGCCAGGGCAGGGGTGACGACCCGTGAGCCAGGAGACCTGCCTCGACAGATAACGTCCTCCG
CC1750 btuB -324 128.8 GCTCTAGCTTCGCGTCAGGTTCCTCGAAAGAGGATGAAAAGGGAACGAGGTTGAAGACCTCGGCTGCCCCCGCAACTGTAAGCGGCGAGCTTCGCGTCACATGCCACTGGGCCCAAAAGGCCTGGGAAGGCGACGCCCAGAAGCATTGACCCGTGAGCCAGGAGACCTGCCCGGCGCAGTCGTTCATCGCT
Caulobacter segnis ATCC 21756
Cseg_1992 btuB -331 116.9 GGCCTTGCGACGCGTCAGGCTCCTCGAAAGAGGATTAAAAGGGAACGAGGTTCAAGGCCTCGGCTGCCCCCGCAACTGTTAGCGGCGAGTTCTAGCGCCATACGCCACTGGGGCCCTCGGGCTCTGGGAAGGCGGCGCCAAGAGCATTGACCCGCGAGCCAGGAGACCTGCCCGGCGCGGTCGTTCATCGCT
Cseg_1811 Cseg_1811 -317 115.1 CGTTTGATAGGGTTGTCGTGGTTCTCCCCATCCTCTTCGGAGGGCGTGGAGCTAAGAGGGAAGCCGGTGCGACGCCGGCGCTGCCCCCGCAACTGTAAGCGGCGAGCCGAAGGTCCATCTCGTGTCACTGACGTCCTCGGGCGTTGGGAAGGCCGGACCGGAAGCCGTGACCCGTGAGCCAGGAGACCTGCCCCGACAGATAACGTCCTC
Cseg_1584 btuR -221 87.9 CTACGCCGGACCTCGAAGGCATGGAGGCTCGCAAGGCCTCCGGGAACGCGGTGACCAATCCGCGGCTGCCCCCGCAACTGTGATCGTCCGTCGATCGTCGCGGCCTCACGCCACTGGGACTTGAAACTCCTGGGAAGGCGCCGCGACGGGAGGGCGTAAGCCAGGAGACCGGCCTTCGTCACATCAACGCGGCC
Caulobacter sp. K31
Caul_2735 btuB -309 109.8 GTGCAGCTCTCGCGACAGGTTCCTCGAAAGAGGATGAAAAGGGAACTCGGGTGTGAAACCCGGGCTGCCCCCGCAACTGTAAGCGGCGAGCCCGCGCGTCATAAACCACTGGGAGCCTCCTTCGGGAGGCCTCTGGGAAGGCGACGCGCACCGGCATTGACCCGCGAGCCAGGAGACCTGCCCGTCGCGGTCGTCCTTCGTC
Phenylobacterium zucineum HLK1
PHZ_c1918 btuB -290 108.9 CGGCGCACTTACCGGGCGTGGCGCCCGAAAGGGCTGAATAGGGAATGCGGTGCGTGCGCTTGCGCACAAGGCCGCGGCTGCCCCCGCAACTGTAAGCGGCGAGCCTTCGACCACCCAAAGCCACTGGGACCGCAAGGTCCTGGGAAGGCCGGTCGAGGGCCCTGACCCGCGAGCCAGGAGACCTGCCACGAGCCGTGGTCACGCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD