Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Caulobacterales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Phenylobacterium zucineum HLK1
PHZ_c1938 ribH2 -267 65.6 TGCGTTCTCAGGGCGGGGTGAAACTCCCCACCGGCGGTAATGCCCTCCAGACCTTGGCGTAGCCTCGGCGACGGAGGGACGAGCCCGCGGGCGCCTGGGCCTTCGTCATAGGAAGGTCCCAGGGACGAGCAGACCCGGTGCGATCCCGGGGCCGACGGTCATAGTCCGGTTATGAGAACGGCCGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD