Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Caulobacterales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC3436 omp -377 53.2 GACGTTGAACGCTGGAAAGCAGAGCGCGCGCCGCTCTCGCCGAAGGAGCAAGGCCTGCCGACTGTCTGGTCGGCCGCTGAATCTCTCAGGCGCCAAGGACAGCGGGGGCAGA
CC3436 omp -462 52.2 AAGGCCTCTCGCGGGAGAGATCGGGCCTTGCCCGGCGCTGAAGGCGAAACCGCCCCGGAAACGCTCAAGCAGAAGGACCGCGCGAG
CC3355 gcvT -260 62.8 CTCGACCCTCGCGGGAGACATCGGGATTCGATCCCGAGGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCAAAAGGACCGCGCGGGTTTA
CC3355 gcvT -165 30.6 ACGCTGGAAAGCAGTCTCTCCACCGGAGGGGCTCGCCGAAGGAGCAAGGCCAAACCCGTCCGGCAGAGGGGCGAGGCCGGAATCTCTCAGGCCCAAGGGACAGCG
Caulobacter segnis ATCC 21756
Cseg_0335 gcvT -145 34.4 GCTGGAAAGAGGCTTCCCGAAAGGGCGGCTCGCCGAAGGAGCAAGGGACCGCGCGTCCCGGAATCTCTCAGGTCCAAGGGACAGCGGG
Cseg_0335 gcvT -240 61.3 TGACCCTCGCGGGAGACATCGGGATTCGCTCCCGAGGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCAAAAGGACCGCGCGAGTTTAGG
Caulobacter sp. K31
Caul_4387 gcvT -157 52.5 GTTTAGGAACGCTGGAAAGAGGCAGTCTGAAAAGACTGCCCGCCGAAGGAGCAAGGTCGGTACCCCGACCGAAATCTCTCAGGTCAAAGGGACAGCGGGGGCGAA
Caul_4387 gcvT -245 50.4 CTCGACCCACGCGGGAGACATCGGGATTCTGGTCTCGAGGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCAAAAGGACCGCGCGGG
Caul_2543 omp -415 45.5 GCGTCGAAACGCTGGAAAGCAGGGCGCGTCTGCGTGCGCCCTCGCCGAAGGAGCAAGGCGGCCCGTGTCGATCAGACGGGTTCGCTGAATCTCTCAGGCGCCAAGGACAGCGGGGGTGCG
Phenylobacterium zucineum HLK1
PHZ_c0592 gcvT -173 40.2 GCTGATGAACGCTGGAAAGTTCCGCGCCTCATAAGGGACGCGGGCGCCGAAGGAGCAGGGGGCCGTCCAACCACCGGACGGCTCGAAATCTCTCAGGCCAAGGGACAGCGGGGGCGCG
PHZ_c0592 gcvT -271 42.4 GCCGACTCTCGCGGGAGAGATCTTCCAAGGCCTCCGGGCCGCGGAGGGAGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCAAAAGGACCGCGCGGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD