Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Rhodobacterales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_2193 gcvT -141 35.4 TCGAAGACTCTGGAGAGAGGCCGGACGGCCCGCCGAAGGGATAACGATCTCAGGCGCAAGGGACAGAGGGGGCACTGC
RSP_2193 gcvT -229 48.9 GCCACAGGATCGGGAGAATCCGGGGGCGACCCCGGTGCCGAAGGAGCAACCGCCCCGGTAAACTCTCAGGCGCAAGGACCGTCCTGTTT
Paracoccus denitrificans PD1222
Pden_2348 gcvT -223 57.6 AGGTCGGAAATCGGGAGACATTGGCGCAAGCCAGGGCCGAAGGAGCAACCGCCCCGGGAATCTCTCAGGCAAAGGGACCGTTTTCCGCCG
Pden_2348 gcvT -130 23.2 GCTCTGGAGAGAGGCGGCTTGCGCCGCCCGCCGAAGGGATAACGATCTCAGGCGCCCCCGTTTCGGGGTAGGGACAGAG
Pden_0183 dadA -211 48.4 ACAGGAGAGTCGGGTTCCCACCCGCGCCGACGGAGCAACGCCCCGGAATCTCTCAGGCACCAGGACTG
Pden_0183 dadA -141 64.3 GGACCGCCACTCTGGAGAGAGATGCGACAGCATCCGCCGAAGGAGAAAGCCGCGAAGCGCGGCGATACTCTCAGGCAAAAGGACAGAGGGGGGATG
Jannaschia sp. CCS1
Jann_3620 gcvT -148 43.9 GACATAACTCTGGAGAGTGAGGGCAGTGCCCCTCCGCCGAAGGGATAACGATCTCAGGCCGAAGGACAGAGGGGGCATCAG
Jann_3620 gcvT -250 41.3 CGCAACCGTAGGGAGACTCTTGGGCGCGCAAACCACGCGCACCCCAGGGCCGAAGGAGCAACCGCCCCGGTAAACTCTCAGGCAAACGGACCTGTGGTTGT
Rhodobacterales bacterium HTCC2654
RB2654_18583 gcvT -144 44 ACGACAGCACTCTGGAGAGTGGCGCATGGGCGCCCGCCGAAGGGATAACGATCTCAGGCGAAAGGACAGAGGGGGCATC
RB2654_18583 gcvT -240 39.1 CCGCATCCACGTTGGGAGAATCTGGCGCCCGCCTGACCGGGACCAGTGCCGAAGGAGCAACCGCCCCGGAACCTCTCAGGCTTCAGGACCGCGTGGA
Oceanicola granulosus HTCC2516
OG2516_12556 dadA -206 40.1 CGGGAGAGCGCGGACACCCGCCGCCGAAGGAGCAACCGCCCCGGTAAACTCTCAGGCACAAGGGACCGGAC
OG2516_12556 dadA -131 48.5 CGCAACACTCCGAAGAGTGGGTCTCTGACCCCGCCGAAGGAGCAAGCCGCAGCACGCGCGGCGAATCTCTCAGGCCCACGACGGAGGGGGCATCGG
Loktanella vestfoldensis SKA53
SKA53_10389 dadA -192 56.9 CACACGCCATCCGGGAGAGAACGGATGTCCGTCGCCGAAGGAGCAACCGCCCCGGTCACTCTCAGGCAAAAGGACCGGTTGGG
SKA53_10389 dadA -110 55.5 GGTGCAACACGCCGAAGAGTGGCCTTTGATGGTCCGCCGAAGGAGCAAGCCCCGCGACGGGTGAATCTCTCAGGCACAGCAACGGCGGGGGCGAG
Oceanicola batsensis HTCC2597
OB2597_14831 gcvT -127 33.4 TCTGGAGAGTGGCGCGGACCCGCGCCCGCCGAAGGGATAGCGATCTCAGGCGCAAGGACAGAGGG
OB2597_14831 gcvT -219 38.5 ACATCGGACAGGGAGAACCGGCCGCGCGCCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAAGGGACCTGCCGGTATCGAA
Roseovarius nubinhibens ISM
ISM_05735 gcvT -173 42.2 ATCGAGGAACTCTGGAGAGTGCGCGGATCAGCCCGCGCCGCCGAAGGGATAGCGATCTCAGGCGAAAGGACAGAGGGGGCATC
ISM_05735 gcvT -257 49.6 AGATATCGAAACGGGAGAACCGGCCATGCCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAGGACCGCTTCGATA
Roseovarius sp. 217
ROS217_16241 gcvT -268 43.7 AGATCGGATAGGGAGAACTGGCACATGCCAGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCGCAAGGACCTGCCCGATC
ROS217_16241 gcvT -185 41.7 CACGGAACTCTGGAGAGACCCCGATCTTGTGCGGGGCGCCGACGGGATAGCGATCTCAGGCGAAAGGACAGAGGGGGCATCGT
Sulfitobacter sp. EE-36
EE36_09003 gcvT -154 48.7 CTAACAACTCTGGAGAGTGACGCGACAGCGTCCGCCGAAGGGATAACGATCTCAGGCGAAAGGACAGAGGGGGCATTTG
EE36_09003 gcvT -239 45.2 ACACCGTTACGGGAGAACTGGCGCAAGCCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCAAAGGACCGCAACGGGA
Silicibacter TM1040
TM1040_2393 gcvT -191 48 GCGTAACTACTCTGGAGAGAGCCCGACCAGATCGGGCCGCCGAAGGGATAACGATCTCAGGCGAAGGGACAGAGGGGGCATC
TM1040_2393 gcvT -293 42.6 GCCGCAGCACATGGGAGAACCGACCAAGAGGCTTGGCGCCTCGCTGATCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCCACAAGGACCGTGTGCG
Roseobacter sp. MED193
MED193_00175 dadA -187 55.4 CCAAGCTGTCACAGGAGAGGCCGACCCAGTCGGCGCCGAAGGAGCAACCCCCCGGCACCTCTCAGGCAAAAGGACTGTGATCAGCGC
MED193_09370 gcvH -348 32.7 CCCTGTGTATATGGGAGAACCGTCGCTGTGATGTCGGGCCTTTGGCCTGCCCCGCAAGCTCGGTGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAGAAGGGACCTTATAC
MED193_09370 gcvH -235 42.2 CACGAAAGACTCTGGAGAGAGCTCGAGGGAACTCGAGCCGCCGAAGGGATAACGATCTCAGGCACCGGGACAGAGGGGGCATC
Hyphomonas neptunium ATCC 15444
HNE_2719 gcvT -150 50.4 ATCAACACGCTGGAAAGAGGCTGAAACACGCCTCGCCGAAGGAGCAAGCCTGTCTTTGACGGGCGGAATCTCTCAGGCGCCCGGACAGCGGGGGCGACGG
HNE_2719 gcvT -238 60.6 ATTCTCTTCCGGGAGAGAGCGGCATTCGGTAGCCGCCGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCAAAAGGGCCGGAAGAGGA
Oceanicaulis alexandrii HTCC2633
OA2633_14096 gcvT -177 42.2 GACCTAACGCTGGAAAGCGGGCGCTGAACACTCAGCGCCCCACCGAAGGAGCAATGCGGGCGCGCCTCTCCCTGGCTGGCGCCGCGCGGGAATCTCTCAGGTCTTCAAGACAGCGGGGGCGAATC
OA2633_14096 gcvT -266 57.3 GGTCACTTGCGGGAGAGACCGGCCGAAGACGCCGGCGCCGAAGGCGCAACCGCCCCGGAAACGCTCAGGCTAACGGACCGCAAGCCTAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD