Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Rhodobacterales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Paracoccus denitrificans PD1222
Pden_4679 ribH2 -198 113.6 CGTGTTCTCGGGGCGGGGTGCAATTCCCCACCGGCGGTTACAGCCCGCGAGCGCCTGCAATCCGCAGGGTCAGCAGATCCGGTGAAACTCCGGGGCCGACGGTATAGTCCGGATGAAAGAGAATGGACGG
Roseovarius nubinhibens ISM
ISM_10606 ribH2 -226 93.8 GCGGCACTCTCAGGGCGGGGCGAAACTCCCCACCGGCGGTAACGGGGCCAGCCCCCGAAGCCCGCGAGCGGCCCCGGTTCTCCGGGGTGTCAGCAGACCCGGTGCAATTCCGGGGCCGACGGTCATAGTCCGGATGGAAGAGAGCGACA
Sulfitobacter sp. EE-36
EE36_07868 ribH2 -240 99.5 TCCCTATTCTCAGGGCGGGGCGCAATTCCCCACCGGCGGTATGTGGCCCCAGTGCCACGAGCCCGCGAGCGCTGGCGACATCCCTTCGGGATGCGCCGGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTCATAGTCCGGATGAAAGAGAATGCGT
Silicibacter TM1040
TM1040_2496 ribN -224 110.3 GATATTCTCAGGGCAGGGTGAAAGTCCCTACCGGTGGTCACAGCCCACGAGCGGCCCTTGGTTTGACAAGGGTGACAGCAGACCCGGCGCAATTCCGGGGCCGACGGTTACAGTCCGGATGAAAGAGAATGGAGAG
TM1040_3310 ribH2 -182 118.9 TTTCCATTCTCAGGGCGGGGTGAAATTCCCCACCGGCGGTTATAGCCCGCGAGCGCCACCTCTACGGGGTGGGTCAGCAGATCCGGTGGAATTCCGGGGCCGACGGTCATAGTCCGGATGGGAGAGAATGTAC
Silicibacter pomeroyi DSS-3
SPO0268 ribH2 -231 102.6 GTGTCGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATGCGGGGCTTGATCCCGCCAGCCCGCGAGCGGCCCCGGCCCACGTCCGGGGTGTCAGCAGATCTGGTGAGAGACCAGAGCCGACGGTTACAGTCCGGATGAAAGAGAACGCAC
Roseobacter sp. MED193
MED193_14447 ribH2 -292 98.8 GCGCTGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATGCGAGGGGTCTCCCTTTGCAAGCCCGCGAGCGGCTTTTGCTGTGTCCACGATCCAAAAAGTGGGAACCGGTTTTTGGATGAATTGTGGAACACCAGCAAAAGTGTCAGCAGATCTGGTGTGATTCCAGAGCCGACGGTCATAGTCCGGATGGAAGAGAACGTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD