Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Rhodobacterales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_2829 cfrX -292 75.6 ACCACTTCCGGCGCGCTGGTTCCTGTCCGACCGGACAGGCGAAGAGGGAATGCCCCAGAGGCAGCCGCCCCCGCGACCGTGACCGGAGAGGTTGCCCAAGCCACTGGCCGCAAGGCCGGGAAGGCGGGCCGCCGCGGAGCCGCAAGGCCCCACATCCGCAAGCCGGGAGACCTGCCAGCGCTGAGACTTACGGGCG
RSP_3186 cbtC -275 109.1 TGTCACGCCGGGCTATGACGGTTCCCGAACGCCGCAAGGTCAAGGGATGAAAAGGGAACGCGGTGAGGGGTGCTGACCCCAGTTCCGCGACTGCCCCCGCAACTGTGAGCGGCGAGCCCGCCCCGAAGACGCCACTGGACCGAAAGGGCCCGGGAAGGTTCGGGGAAGGCCGCGACCCGCGAGTCAGGAGACCTGCCGTCGAGCGCGCAAGCGCC
RSP_3218 bluB -223 92.2 CTTTGTGGCAGGGGTCAGGTGCCGCCTTCGGGCGGAGAATCGGGAAGCCGGTGGAAATCCGGCGCGGGCCCGCCGCTGTGACGGGGATGCTCCGGGCAAGAGGCCACCGGTTCGCCGGGAAGGCGCCCGGCGGCAGATGAACCGGAGCCAGAAGACCGGCCTGACGCAGAGGTTCCCGCCG
RSP_2402 btuB -326 129.1 TATTGAGGAACGGCTTCGGTTCCGGCGTGATGGCCGGATGAAAAGGGAACGCGGTGCGGGGAGATCTCCCCAACTCCGCGGCTGCCCCCGCAACTGTAGGCGGCGAGCGACGACCGACGGCGCCACTGGGATGTCCCGGGAAGGCCGGTCCGAGCTGCGACCCGCAAGTCAGGAGACCTGCCGGAGCGATCACCCTTTCCTG
RSP_0787 RSP_0787 -293 107.7 CGGAAGGTGCGGGCGACGGTTCCCGGAGGAAGCTCCGGGCGAAGAGGGAATGCGGTGCGGGCCTGACAGGCCCCAAGCCGCGACTGCCCCCGCAACTGTAGGCGGCGAGCGCGTCCCATCATGCCCACTGGCCCAGGACAGGCCGGGAAGGGCGGGACAAGCCCAGACCCGCGAGTCAGGAGACCTGCCGTCGACGGACCTGTAACAGC
RSP_3392 btuF -373 100.6 CGGCTACTCAATCCTCGTCGGTTTCCGTAAGGAATTGAAAGGGAATCCGCCGCCGGACCTGTCCGGCGAACCGGAACTGCCCCCGCAACTGTAGGCGGCGAGGAGCTCGCGATCAAAGCCACTGTGGCCTCAAGCCATGGGAAGGCCGCGCCAGCCCTGTGACCCGCCAGTCAGGAGACCTGCCGGCGTTCGATCTCAACGC
Paracoccus denitrificans PD1222
Pden_2530 cfrX -277 85.2 CACAGACATGGGGCGCTGGTTCCTGTCCTATGACAGGCTAAGAGGGAATGCGACAGGCAACCGCCTGAAAGCAGCCGCCCCCGCGACCGTGACCGGAAAGGTCGCCCCTCTGCCACTGGCGAAAGCCGGGAAGGCGGGGCGGCCGTGGGCCCAGGCCCGAATCCGCAAGCCGGGAGACCTGCCGGTGCAGAAGGATTGACCGG
Pden_2524 cbtB -241 133.6 TAACATATGCGTGTATCGGTGCCCCTTTCGGGGCCAAAAGGGAATGCGGTGCCGTCTCCGGCGTCTTGGGGACCAAATCCGCAGCCGCCCCCGCGACTGTAGGCGGAGAGCGGACGCCCATCGTGCCACTGGCCATCCGGCCGGGAAGGCGGGCGTCAGCCGTGACCCGCGAGCCAGGAGACCTGCCGATGCGTGAAACCGCAATGT
Pden_1368 btuB -347 131.2 GCCATGAGGGCCGAGCTACGGTTCCGGCGGCGTGCCTCCGGATTAAAAGGGAATCCCGGTGCGCCTGACCTGTTCAGGCAATGCCGGAGCTGCCCCCGCAACTGTATGCGGTGAGTGACGGTCGATCATGCCACTGGCGCGAATGCGCCGGGAAGGCCGGCCCGAACGATGACCCGCAAGCCAGGAGACCTGCCGCAGCAATCACCCATTTC
Pden_4382 btuB -349 101.9 CAATGCGGGGCCGCTACGGTTCCGGCGCGATCTGCCGGATGAAAAGGGAACACCGGCGCGCCCATCGCCGCGATGCGGACGGGCAAGGCCGGGGCTGCCCCCGCAACTGTAGGCGGTGAGCGAAGGCCGAAGGCGCCACTGGGAAGATCCCCGGGAAGGCCGGCCCGAGCGATGATCCGCCAGCCAGGAGACCTGCCGCAGCGATCACCCATTTCCG
Pden_1362 btuF -293 104.1 GCGCTATGGCGGAGTTGTCGGTTTCCGCAAGGAATTGAAAGGGAATCCGCCGGGGCATCAGCCCCGAACCGGAACTGCCCCCGCAACTGTAGGCGGCGAGCAGGGTGCGAAACAGCCACTGTGGCCCATGCCATGGGAAGGCCGCATCCCTGCCGTGACCCGTCAGTCAGGAGACCTGCCGACGCGATGACCAACCCG
Pden_2980 btuF -322 101.5 TACCAAGTCGCTGCATCGGTTTCCGCAAGGAATGAAAAGGGAATCCAGCGCGCCCGATGGGCGCGAAACGGAACTGCCCCCGCAACTGTAGGCGGCGAGCGCGATCTGGCAGGCCACTGGGCACGATGTCCGGGAAGGCAGGATCCGCGCAACGACCCGCCAGTCAGGAGACCTGCCGGCGCGAATTCACCAGAC
Pden_4375 nrdH -284 121.4 CTAACTGCAACGGTCATGGTTGTCCCGGGGCCGACTCGGGGATGAAAAGGGAAGCCGGTGAAAAGCCGGCACTGCCCCCGCAGCTGTAAGCGGAGAGCGACGCCGGATCACCACTGGGGCCACGCGCCCCGGGAAGGCCGGCCAAGCCGAGACCCGCAAGTCAGAAGACCTGCCATGACGCGAAAGGACGAAAC
Pden_1354 Cseg_1811 -326 132.3 TTTTACCGTCAGATCAAGGTGCCGGGGAAATCTCCGGGTAAAAGGGAATTCGGTGAGGCTGTCGCCAAATCCGAAGCTGCCCCCGCAACTGTAGGCGGAGAGCCTGTCCGACATGCCACTGGCGCGGATTTCGCGCCGGGAAAGCTGGACCAGGTAAAGATCCGCAAGTCAGGAAACCTGCCTGGATCAATCACCTGTTCCG
Pden_4827 btuB -408 127.9 CTACACGGTCGGGTGACGGTTTCCGATTTCGGAATGAAAAGGGAACGCAGTGCGGACCAGCCGGTCCCATGCTGCGGCTGCCCCCGCAACTGTAGGCGGATAGCCTTTGCCAACGGCCACTGGGTGCGACCCCGGGAAGGCGGCGACAGGCGACGACCCGCGAGCCAGGAGACCTGCCGTCAGCCGTTGTCACGCGTG
Pden_2989 nrdD -414 119 CCCTATATGTAGGCATCACGGTTCTTTCGGGTCGATCCGACCCGAAAGCGAAGAGGGAAGCCGGTGCGCCTTTCGGGGCAAGGCCGGCGCTGCCCCCGCAACTGTAAGCAGCGAGCCTGCGCCGGATCACGCCACTGGTGCCGCACGGCATTGGGAAGGCCGGCAAGGGCAGCGACCTGCGAGCCAGGAGACCTGCCGTGATGATGACGATGAAC
Jannaschia sp. CCS1
Jann_2934 cfrX -221 141.5 TGAACAGGGTCACGGCGATGGTGCCCTTCTTGGAGGGCCTAAGAGGGAACGCGGTGAAACCCCGCGGCTGCCCCCGCAACTGTAAGCGGTGAGCGGACCTGCGTATGCCACTGAGCCGACAAGCTCGGGAAGGCGCAGGCCCCGCCCTGACCCGCAAGCCAGGAGACCTGCCATCACCTGTGAAACGCAT
Jann_2250 cbiW -273 140.2 CTGAAATCAAACTGGTGATGGTGTTTCGACATCCAAGACGATGTCGGACTGAAAAGGGAATACGGTGAGGACGCGCCTTAGGGCACCAAATCCGTAACTGCCCCCGCAACTGTAAGCGGTAAGCGACGCCAAATATGCCACTGGGACAGCTCCCGGGAAGGTTGGCCAAGCGTTGATCCGCAAGTCAGGAGACCTGCCATCAGGTGTTGAAACATT
Rhodobacterales bacterium HTCC2654
RB2654_11383 cbtB -238 92.6 CCACAAGGATAAGGCATGGTTCCCGACACGGCGCAAAGCGCCAAGGGAGAATATGGGAATGCGGAGGGGTGATCCAAACCGGAGCCTTCAGCCGCAGCCGCCCCCGCGACTGTGACGCGGCGAGCGCCCGCCGGATACCACTGAGCCTCGGCTCGGGAAGGTGGCGAAGCGCGACGACCCGCAAAGCCAGGAGACCTGCCATGTGAAACGAAACCCCACC
Oceanicola granulosus HTCC2516
OG2516_10826 hupE -305 109 CACAAAGATCCCCGCATGGTTCCAGCCGGACGCGTCACGCGGCCGAGGATCAAAAGGGAATGCGGTGCGGGCGGATCCAAACAGGACGCCCAATGCCGCAGCCGCCCCCGCGACTGTCAGCGGAGAGCGTCTCGCCATCGCCACTGGGCAACCGGGAAGGCGGCGCGACGCAGTGACCCGCAAGCCAGGAGACCTGCCATGCACCGGCTTTTGCCGGG
Loktanella vestfoldensis SKA53
SKA53_10069 hupE -323 106 GCACAACATGACGGCACGGTTCCCCGCACGGCGCGCAGCGTCAGGGGATCAAATGGGAATGTGGACGCGCCGATCCTGTCAGGGAGGCGCCAAGCCACAGCCGCCCCCGCGACTGTATGCGGAGAGTGCCTTGTTAACATGCCACTGGGTCCGCCCGGGAAGGCAACAAGGTGCATCGACCCGCAAGCCAGGAGACCAGCCATGCACCGGGGATCGCCCCG
Oceanicola batsensis HTCC2597
OB2597_10304 cbtC -244 106.7 GCACAACCGAAAGGCATGGTTCCTCAGACGGGTCTCAGGCCCGAGGATCAAATGGGAATGCGGAGAGGCGACCCACATCGGGGCCTTCAGCCGCAGCCGCCCCCGCGACTGTGAGCGGAGAGCATGTGTCACGAGCCACTGGGCAACCGGGAAGGCGGCACGATGCGACGACCCGCGAGCCAGGAGACCAGCCCTGCGTCAATTCTAACCGGC
Roseovarius nubinhibens ISM
ISM_12600 cfrX -321 128 GCATTGTCGCCCCTGATGGTTGCCCGGGACGAATCCGGGCTGAAAAGGGAACGCGGTGCGGGTCTGACCCAATTCCGCGGCTGCCCTCGCAACTGTAAGCGGCGAATGTCTCGCACCATGCCACTGGCCCTCGGGCTGGGAAGGCGCGACCCATGATGACCCGCAAGCCAGGAGACCTGCCATCCAGGGCGCTGTCCGGCG
ISM_12665 cbtC -235 117.5 ATCTCCTTCCATTCGATGGCGTCACGCAAGTGGCTGAAAAAGGGAACCGGGTGAAACCCCCGGACTGCCCCCGCAACTGTAAGCGGCGAGCGTTTAGGAAAACCACTGGCCCGAGCTGGGCTGGGAAGGCCGACAACGCGACGACCCGTAAGTCAGGAAACCTGCCATTGATCATCTGCCGCGAGA
ISM_07745 btuF -322 109.4 CGGGTGTCACTGCGGCGTCGGTTTTCGATGGAAACTAATAGGGAATCCGCGGCGTCCAGCAGGGCGTCAACCGGAACTGCCCCCGCAACTGTAGGCGGCGAGCTGCATCTTCAGAACCACTGGGCCGAGGTCTGGGAAGGGAAGATGACGCCATGAGCCGTGAGTCAGGAGACCTGCCGACGCATAACCTGAAACC
ISM_13370 ISM_13370 -341 104.7 TAGGCTAAAGCTCTCAGGGTGCCGTCCTCGCAAGGGGCCGGAGAATTGGGAAGCCGGTGCAAGTCCGGCGCTGCCCCCGCAACGGTAAGGAGGGGTGGTTGGGCGATATGCCACTGGGCCGCGAGGCCTGGGAAGGTAGCCCGATCACAGGCCAGATGGCCGTCCACCAAGCCCGGAAACCAGCCATGAGACAACGTCAGAACCG
Roseovarius sp. 217
ROS217_07994 cbtB -256 111.3 GCATACGAGAGTGGCAAGGTTCCTCGTTTCGGTGCAAAGCGCCGCGAGGATAAATGGGAATGACGTGCCGGCGGACCCAATCAGGGCGTCCATGCGTCAGCCGCCCCCGCGACTGTAAGCGGCGAGCCCCTGCCAGATGCCACTGAGGTGTAAAACCCTTGGGAAGGCGGCAGACAGGCGACGACCCGCGAGCCAGGAGACCAGCCCTGCGTTTGTTAATCCCGCC
ROS217_16870 ISM_13370 -306 107.2 TAGGCTGATCCTGTCATGGTGCCATGCCGACAGCAGTCCACTGCTCTCGGGATGGAGAATTGGGAAGCCGGTGCGATTCCGGCGCTGCCCCCGCAACGGTAAGGGAGGGCGTTTCGGCGATATGCCACTGGGCGACAATGCTCGGGAAGGTGCCGCGACGCGAGGGTCATCCGGCCCGCCATCCAAGCCCGGAAACCAGCCTTGGCGTGACGTCGAATCGC
Sulfitobacter sp. EE-36
EE36_10479 bluB -227 104.6 GCCCAATGGCCGGGTCTGGTGTCCGCCTCGCGGAAGAATCGGGAAGCTGGTGAAACTCCGGCACGTGCCCAACGCTGTAATGGGGATGGTTTGCGCATAGGCCACTGGAATATTCCGGGAAGGCGCGCGGACCAGACGACCCTAAGTCAGAAGACCGGCCAGACAGTACAGCTTGCCCCG
EE36_05358 cfrX -311 88.9 AATGCAGGGCGTATGTTGGTTCCTGTCCCAGACAGGCGAAGAGGGAACGCGATACGCATTGATCCAGCCTTGGGTCAGCGCCAAGCGCAGCCGCCCCCGCGACCGTGACCGGAGAGAGCTTTCAACCACTGGCCCGCAGGCTGGGAAGGTGAAGGTTCGCAAGGCAAGCTGCCTTAGATCCGCAAGCCGGGAGACCTGCCAGCATAGTTTGTAACGGGCG
EE36_05423 cbtC -288 110.7 GACCACCTATTCCGGACGGTTCCCCGTGCGCCTTCGGGCAATCGGGGTGAAAAGGGAATACGGTGCGGTGCCAAAGCAAAGGTGCCAAATCCGGAACTGCCCCCGCACCTGTAAGTGAAGAGCAACCCGCATTGCCACTGGGCCACACCGCCTGGGAAGGCGCGGCACGCATGGACGCACAAAGTCAGGAGACCTGCCGTCATGGGGATGATCCCCGA
EE36_12323 btuF -344 118.9 CTGTCATCGAAACCGGGTCGGTTTCCTTCGGGAAATAATAGGGAATTCGCCATCCGCCCTTTGGTGTGGATGAACCGGAACTGCCCCCGCAACTGTAGACGGTGAGCTACCTCCATCATGCCACTGGGCCTAAAGGTCCGGGAAGGCGGGGACAGCCGCGATCCGTCAGTCAGGAGACCTGCCGACACTGAACCTGAAACA
Silicibacter TM1040
TM1040_2222 cbtA -352 112.8 CATTGTCGACGGCATACGGTGTCCCAGAGCGCAAAGCGCCGGGACTGAAACGGGAATGAGGAACGGCGGACCCAATCGCGGCGCCAAAGCCTCAACCGCCCCCGCGACTGTGAGCGGTGAGCGACATTCAGCATCCACTGGCCGCTGGGCCGGGAAGGAGAATGATCGCCGCGACCCGCGAGTCAGGAGACCGGCCGTATGAAACGAGGACAGTGA
TM1040_2208 cfrX -336 77.8 CGCAAGGAAATTTCGTTGGTTCCCGAAGGTGACAGCCTTTGGGCGAAGAGGGAATGTGTCGGGCCGGGATCATCCTTGCTCCAAACACAGCCGCCCCCGCGACCGTGACCGGAGAGGTCTTCCAACGCCACTGGCGCGCCCCTTGTGGGCAGGCCGGGAAGGCAGGGAGACCGTTCGCGCCCCACTCGGGGCGGATCTATCCGCAAGCCGGGAGACCTGCCAACGCGTGAGAACCGGCGGA
TM1040_0168 RSP_0787 -308 125.5 GCGTAGCATCCAGACAGATGGTTCCTGCCTCTGTTTGGGGTGGGATGAAAAGGGAATACGGTGAGGCTTTGGACCATTGGGTCCCGCCAAGTCCGTGACTGCCCCCGCAACTGTGAGCGGCGAGTTCCCCGGCAAAGCCACTGACCCCAACGTCGTAACCGGCAAAAAAGGGTCGGGAAGGGCCGGTTCGCGATGACCCGCAAGTCAGGAGACCTGCCATCGGCAATGTAAACCTG
TM1040_2933 cbiW -302 134.4 CGCATGAGAGGGGCGATGGTTCCCCGACGCCTAAGGCCGGTGGGATGAAAAGGGAATTCGGTGCGGAGGAGCCAAAGGGCGCCAAATCCGAAACTGCCCCCGCAACTGTAAGCGGCGAGCGCCCCGTCACAGCCCACTGATCCTCATGGATCGGGAAGGGAGGGACGCGCAATAACCCGCAAGTCAGGAGACCTGCCATCGCGACTTTTTAACCAAG
TM1040_0521 nrdH -295 121.7 ATCAATATCGTGTTGCTTTGGTTCTTTCGAGGCGACTCGCAAGCGAAGAGGGAAACTGGTGAAAATCCGGTGCTGCCCCCGCAACTGTAAGCGGCAAGCCCTGCCCGTGCCACTGACGCATCGCTGCGTTGGGAAGGCGGGAGGGGGCGTTTGAGCCGCGAAGCCAGGAGACCTGCCAGAGCACGACACACGACG
TM1040_3219 ardX -338 106.6 ATACAACTCTGCCCTACGAGGTGCTGTCCGGGCTTTCCGGACGGAGAATTGGGAAGCCGGTGCGATTCCGGCGCTGCCCCCGCAACGGTCATGGGATTCGCGGGCGTAACATCTGCCACTGGGAGGAGGACCCGGGAAGGCGTTGCGCTCCGACCAGCAGGTCACCCCCAGAGCCCGGAAACCAGCCTCGGCAGATATCGTCAAC
Silicibacter pomeroyi DSS-3
SPO2875 cbtB -222 119.1 GCTAAATGAAGGGGTCTGGTCCTGCCGGAGCAATCCGGATGCTAAGAGGGAATTTGGTGCGACCGCCCGTCGGTTCAGGCCAAAGCCGCCCCCGCGACTGTAAGCGGTGAGCCTCTGTTCAACCAGCCACTCCCGGGTTCGCCCCCGGGGGGAAGGCGAACAGAGGCACTGACCCGCGAGCCAGGAGACCTGCCAGACAGGCACTGTAACACCG
SPO2861 cfrX -292 81.8 CGCATGTCCGCCCTGTTGGTGTCCGGGCAACCGGATGAAAAGGGAATGCGCCAGCGGTTCCGGGACATGATCCCGGGCAGCCGTCAAGCGCAGCCGCCCCCGCGACCGTGACCGGAGAGGGTGCCCAAGCCACTGGCCAAATGGCCGGGAAGGCGGGACATCCGCCAGAGCAGCGCTCTGACATCCGCAAGCCGGGAGACCTGCCAGCACCCGAACTGCAACCGG
SPO3547 RSP_0787 -251 120.6 GCTACCGCTGGGTCGATGGTTCCCGGTCGTGCATGCGCCGGGATGAAAAGGGAACACGGTGCGGCCCTCTGGCGACAGAGGACCAATGCCGAGACTGCCCCCGCAACTGTAAGCGGTGAGCGATGCCGAAATGCCACTGGCCCCCGGGCCGGGAAGGCCGGCAAAGCCCGGACCCGCAAGTCAGGAGACCTGCCATCGCAACCGTAACTCGAAC
Roseobacter sp. MED193
MED193_19614 cfrX -216 93.5 GCGCAAGGGGGTTTTTGTTGGTTCCTGCAAATTGCAGGCGAAGAGGGAATGTGACAGGCTGATAGGGATTTTTGCTATCAGCTCTCAAGCACAGCCGCCCCCGCGACCGTGACCGGAAAGGTCTCTGATGCCACTGGCCCACCGTGCCGGGAAGGCAAGAGCACCGCAGACAGGCATCGCCCGTCGAAATCCGCAAGCCGGGAGACCTGCCAACGCATGAGACAACGAG
MED193_19549 cbtC -280 126.3 AGAGCAGTGACCTATCGATGGTTCCACTGAAGCCCAAGGCTTTTGGATGAAAAGGGAATCCGGTGAGGTGTAGCCAAAAGGCGCCAAACCCGGAACTGCCCCCGCAACTGTGAGCGGCGAGCCACTGGGATAAGCCACTGATCTGCACAGCAGGTCGGGAAGGCCCCAGACCGGCCCAGACCCGCAAGTCAGGAGACCTGCCCTCGTGAGTTGACCATAG
MED193_11852 RSP_0787 -441 123.2 ATAGCCGTGTAACGGATGGTTCTTGCGACGCATAAATCTAGTGTCCGGGATGAAAAGGGAACGTGGTGCGGAGAGGTTAGTTCAGCCGATCCAATTCCACGACTGCCCCCGCAACTGTAAGCGGTGAGCGCTTCGGATTAACCACTGGTACAGGGACATGATCCCCGGCTGGGAAGGACCGAAATCGCGTTGACCCGCAAGTCAGGAGACCTGCCATCACGTATGAAACTCGAAA
MED193_18509 btuF -303 112 TCTAAACGGCAAGAGTCGGTTTTCTAGGAAATTAATAGGGAATTCGTGGCGACAAACCTGTAGCTAAGCGAAACTGCCCCCGCAACTGTATGCGATACGCCGCATTTCGAGATCCACTGGGCTGAAGGGCCTGGGAAGGTGAAATGAGGCTTAAGTCGTTAGTCAGGAGACCTGCCGACATGACACTGGAACCGGA
Hyphomonas neptunium ATCC 15444
HNE_1142 btuB -248 112.1 CGCCGCCTCACGCAACAGGTGCCCGGATCATGGTCCGGGTGAAAAGGGAAGCCGGTGAGAATCCGGCGCTATGCCCGTAACTGTGAGCGGGGAGCCGTGTGAGCCATACGCCACTGGGAAACCGGGAAGGCAGCTCTCTCCGGCGATGATCCGCGAAGTCAGGAGACCTGCCTGTTGCCGTCGTTGGCTCGC
HNE_1514 btuB -355 140.2 CATCAACCCCATCAGATGGTGCTCCCCTGACAGGGAGCTAAGAGGGAAGCCGGTGTAAATCCGGCGCTGTACCCGCAACTGTTAGCCGGGAGCTGATGGCCACTATGCCACTGGAACGCGAGTTCTGGGAAGGCGGCCAAAGGCGACGATCGGTGAGCCAGGAGACCTGCCATCGCGTCGTTTGTCCGGAG
Oceanicaulis alexandrii HTCC2633
OA2633_11725 btuB -352 110.5 ACACCGACATACGCGACGGTTCTCCCGCGAGGGAGCGAAGAGGGAACACCGGTGCGACGCGCGAGCGTCTGGTCCGGGGCTGTACCCGCAACTGTGAGCGGCGAGCGAGGCGTCAACAGCCACTGGATCGTCAGATCTGGGAAGGCGGCGCATCGCATTGACCCGCAAGCCAGGAGACCTGCCGACGCGGTCGCTCGTTCACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD