Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CmbR in Streptococcaceae

Properties
Regulator family: LysR
Regulation mode: repressor (activator)
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine
Regulog: CmbR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_2344 gshT -136 4.5 ATCATAAATCTTTTTTATGGT
LACR_1009 tcyA -77 5.1 GCTATAAGTTTTTTTTATGGC
LACR_0360 plpA -476 4.4 TTTATAAATTAAACTTAAAAA
LACR_0068 cysD -171 4.4 ACTATTTAAAAATTCTATAAC
LACR_1368 metE -39 4.7 TTGATAAGATAGACCTATTAA
Lactococcus lactis subsp. lactis Il1403
L162009 tcyA -77 5.1 GCTATAAGTTTTTTTTATGGC
L75975 cysD -172 4.2 TCCATTAAAAAATCATATCGA
L0101 metA -132 4.3 GCCATAGGCAAGTTTTATTAT
L121253 gshT -136 4.7 GTCATAAATCTTTTTTATGGT
L117444 plpA -514 4.4 TTTATAAATTAAACTTAAAAA
L167675 dfpB -59 4.8 TTGAAAAAATATTTTTATTAG
L0088 cysK -87 4.5 ATCATAAATTTTTTTTAGAGC
L0181 metB2 -79 5.3 GCTATAAAAAAATCTTATAGC
L0100 metE -76 4.1 ATCATATTAAAAATGTATTAT
L0100 metE -39 4.7 TTGATAAGATAGACCTATTAA
Streptococcus agalactiae 2603V/R
SAG0290 tcyA -75 4.7 CTGATAAGGAAATACTATTAT
SAG0290 tcyA -96 5.5 TTGATATAAAATCTTTATCAC
SAG1306 mmuP -97 4.9 GTAATAGTTTTTCTTTATCAT
SAG1587 metC -152 4.5 ATGATAAATTAAAATAATAAA
SAG2049 metE -109 4.1 GCTAAAAATATAAAATATTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0381 gshT -75 5 TTGATAGGAATTAATTATTAG
SDEG_1719 tcyB -99 5.3 GTGATAAGTTTTGCTTATTGC
SDEG_1040 dfpB -10 4.4 ATGATAAAATATGGCTATGAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1680 gshT -41 5 ATGATAAACTAATCTTATGAA
Sez_0944 dfpB -177 4.7 TTGATAGTATCATTATATCAC
Sez_0944 dfpB -10 4.3 CTGATAAAATATGGCTATGAA
Sez_1582 tcyA -98 4.7 TTGATACTATTTTCTTATTGC
Sez_1582 tcyA -76 4.2 TTGATAGAGAAATGATATTAT
Sez_1580 tcyB -106 5 GCGATAGGCTTTTCTTATCGT
Streptococcus gallolyticus UCN34
GALLO_1275 tcyD -104 4.9 GCTATAAGCAAATCTTATGGC
GALLO_0824 metA -107 4.3 ATTATAGCTAAAAACTATAAC
GALLO_1277 homR -113 5.9 GTTATAAAAAAATCTTATCAC
GALLO_1277 homR -175 4.4 ATAATCTAAATTTTTTATTAT
GALLO_1848 yvdE -61 5 AGGATAGAATAATCTTATCAC
GALLO_1848 yvdE -98 5.2 GTGATAAAAAAAATCTATTGG
GALLO_1237 str1582 -96 5.3 GCTATAAAAATTATTTATGGC
GALLO_0414 tcyA -100 5.2 CTGATAGTTTTTTCTTATCAA
GALLO_1845 gshT -122 6 GTGATAAGTTTTATTTATCAC
GALLO_1316 metE -172 4.6 GTTATAGTTAAAAACTATAAT
GALLO_1316 metE -221 4.2 ATAATAAATTTTATTAATCTA
GALLO_1768 metB -142 5 GTTATAGTTTTTACTTATAGC
Streptococcus gordonii str. Challis substr. CH1
SGO_0985 str1582 -139 5.2 CTTATAAATTTTTTCTATCAG
SGO_0985 str1582 -117 4.9 CCGATAAAATATACATATTAT
SGO_0578 tcyB -170 4.7 GTCATAAAATTTGCTTATACC
SGO_0578 tcyB -148 4.3 TTGATAAATAATTTATACTGT
SGO_0167 yvdE -97 5.5 TTGATAAAAAATTTTTATAAG
SGO_0457 gshT -85 4.7 GCAATAAATAAAATTTATACC
SGO_0310 metE -182 4.2 GTTATAGTTTTTGATTATACC
Streptococcus mitis B6
smi_2060 cysK -98 5.3 GATATAAAAAAATCCTATCAC
smi_1946 gshT -99 5.1 GCCATAAAGAAAACCTATCAC
smi_1579 gshT -101 5.1 ATGATTAAGTTTTTTTATCAC
smi_1382 tcyB -164 4.7 GAGATAGTTTTTACTTATCTC
smi_1382 tcyB -142 5 TTGATAGATAAAATATATAGC
smi_1436 str1582 -80 4.4 GCAATAAAAAATAGATATTAT
smi_1436 str1582 -102 5.5 ATGATAAAAAATCCTTATAAC
smi_1945 gshT -99 5.1 GCCATAAAGAAAACCTATCAC
Streptococcus mutans UA159
SMU.930c homR -110 5 GCCATAAGAAAAAGTTATCAC
SMU.932 tcyD -168 5 GTGATAACTTTTTCTTATGGC
SMU.930c homR -175 5.3 GCTATAAATTTTATTTATGAC
SMU.932 tcyD -103 5.3 GTCATAAATAAAATTTATAGC
SMU.1942c gshT -76 4.6 GTGATAGAAATTATATAATAG
SMU.459 tcyA -102 5.8 GTGATAGAAAAATATTATCAC
SMU.459 tcyA -80 5 GTGATAGGAAAAAACTATTAT
SMU.1942c gshT -98 6 GTGATAGAATTTTCTTATCAC
SMU.873 metE -188 4.6 GTTATAGATGAAAACTATAAC
SMU.1675 metB -110 4.3 CTTATAGTTTCTTTTTATAGC
Streptococcus pneumoniae TIGR4
SP_2072 yvdE -64 5.2 TCCATAAAAAATGTTTATCAC
SP_1461 tcyB -164 4.3 GAAATAGTTTTTATCTATCTC
SP_1461 tcyB -142 5.2 TTGATAGATAAAATATATAAC
SP_1576 metA -145 4.6 GATATAAAAATAGACTATAAC
SP_0711 str1582 -140 4.4 GCAATAAAAAATAGATATTAT
SP_0148 gshT -99 5.3 CCCATAAAAAAAACTTATCAC
SP_0620 gshT -100 4.9 ATGATTAAGTTTTTCTATCAC
SP_0585 metE -218 4.9 CTTATAAGAATTACTAATAAC
Streptococcus pyogenes M1 GAS
SPy0317 gshT -75 4.5 TTGATAGGAATCAATTATTAG
SPy1221 dfpB -16 4.7 TTGATAAAATATGACTATGAA
Streptococcus sanguinis SK36
SSA_1868 tcyB -228 5.3 GTGATAAGAAAAATATATTAG
SSA_1868 tcyB -250 5.4 GTGATATACTTTTCTTATCGC
SSA_0588 gshT -100 4.8 CTGATAAAGAAAAGCTATCAC
SSA_2105 tcyD -194 5.3 TTGATAAAAATTACCTATCTC
SSA_2105 tcyD -59 5.1 TTGATAAATATTTTTAATCAG
SSA_2164 yvdE -100 5.8 CTGATAAAAAATTTTTATAAC
SSA_0416 metE -182 4.3 GTCATAATTTCTACCTATAGC
Streptococcus suis 05ZYH33
SSU05_1306 metA -46 4.7 GTTATAGCCAAAACTTATAAC
SSU05_1773 yvdE -95 5.3 CTGATAGTTATTTTTTATCAA
SSU05_1774 metE -237 4.3 TTCATAGATAAAATCTATACC
SSU05_1562 metB -120 5.1 GTTATAAAGAAAAACTATAAC
Streptococcus thermophilus CNRZ1066
str1653 tcyB -217 5.8 GTGATATGATTTACTTATCAC
str0296 gshT -98 5.7 GTGATAGTATTTTCTTATCAC
str0908 gshT -101 5.2 TTGATAGATATTGTTTATCAG
str1582 str1582 -215 5.2 TTGATAAAAAATACATATTAT
str1582 str1582 -237 4.8 GTTATATCTTTTCTTTATCAC
str0452 homR -108 5.3 TTTATAAAAATTTCATATCAG
str0367 COG1739 -16 5.2 ATGATAAAATTTTTTTATGGA
str0790 dfpB -83 4.3 GTTATAACTTTATTTTATATG
str0583 mmuP -22 4.8 GTGATAGTTTTTCTCTATCTC
str0352 metB -132 4.5 GTTATAGTAATAAACTATATC
str0785 metE -119 4.2 GCTATACAAATATCTAATTAA
Streptococcus uberis 0140J
SUB1379 cysK -104 5.1 ATGATAAGCCTTTCCTATCAC
SUB0365 gshT -93 4.9 GTGATAGAGAACTATTATCAT
SUB0365 gshT -71 4.2 GCGATAGTGAATCACTATTAG
SUB1416 tcyA -76 4.2 TTGATAGAAAAATGGTATTAT
SUB1415 tcyB -80 4.8 GTGATAGGCTTTAACTATTGC
SUB1416 tcyA -98 4.5 GTCATATAAATAGCTAATTAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD