Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR2 in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactococcus lactis subsp. cremoris SK11
LACR_1803 rbsR2 -66 6 AAATGAAAACGGATACAATC
Lactococcus lactis subsp. lactis Il1403
L0145 rbsR2 -66 6.2 TAATGAAAACGGATACAATT
Streptococcus agalactiae 2603V/R
SAG0119 rbsR2 -38 5.4 TTGTGAAACCGTTTCCACAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_1537 rbsR2 -67 6 AAAAGAAAACGGTTACAACA
SDEG_1537 rbsR2 -43 5.4 ACGTGAGAACGGTTCCACAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_0468 rbsR2 -62 6.3 TTTAGAAAACGGTTACAATA
Sez_0468 rbsR2 -39 5.6 ACATGAGAACGGTTCCACAA
Streptococcus pyogenes M1 GAS
SPy1535 rbsR2 -367 3.7 CATAAAAAACGGTTGAACCA
Streptococcus uberis 0140J
SUB1312 rbsR2 -47 6.7 TAAAGAAAACGGTTACAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD