Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Lactobacillaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Lactobacillus acidophilus NCFM
LBA0405 groS -159 7.6 TTAGCACTTTTTTATAAAGAGTGCTAA
LBA0205 hsp -126 7.1 TTAGCACTAAATATTAAAGAGTGCTAA
LBA0638 clpL -70 6.8 TTAGCACTTGACTACCAAGAGTGCTAA
LBA0694 clpP -59 6.1 TTAGCACAGTACTTGTATGAGTGCTAA
LBA0405 groS -84 6.8 TTAGCACTTAACTAAAAGGAGTGCTAA
LBA1910 clpC -57 6.9 TTAGCACTCAACGCACTAGAGTGCTAA
LBA1249 hrcA -93 6.1 TTAGCACTCAGGTTGCATTATTGCTAA
LBA1249 hrcA -45 6.1 TTAGCACCTGATAGATGTGAGTGCTAA
Lactobacillus brevis ATCC 367
LVIS_1331 hrcA -43 6.9 TTAGCACTTGTGTTGTTTGAGTGCTAA
LVIS_1331 hrcA -127 6.1 TTAGCACTTAATTACGTTGATTGCTAA
LVIS_1554 clpL -205 6.4 TTAGCATTCTATTGACGAGAGTGCTAG
LVIS_0617 groS -62 6.4 TTAGCACTTATGTTAGTCAAGTGCTAA
Lactobacillus casei ATCC 334
LSEI_2239 groS -56 6.7 TTAGCACTTAGACATAACGAGTGCTAA
LSEI_1762 clpL -257 5.9 TTAGCACTCTTAGTGGCAGAGTGCTTG
LSEI_0963 clpP -51 6.9 TTAGCACTGTACTTTTAAGAGTGCTAA
LSEI_1567 hrcA -42 7.6 TTAGCACTCATATAAAACGAGTGCTAA
LSEI_2800 hsp -97 6.7 TTAGCACTCGACGTTTGCGAGTGCTAA
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
LBUL_0510 clpL -201 6.9 TTAGCACTTGACTAACTAGAGTGCTAA
LBUL_1229 hrcA -92 5.7 TTAGCATTCTCCTTGACTAACTGCTAA
LBUL_0559 clpP -49 7.1 TTAGCACTGTATCTAAATGAGTGCTAA
LBUL_0243 hsp -154 6 TTAGCAGTCAAAAAAGCTGAATGCTAA
LBUL_1497 groS -140 6.5 TTAGCACTCTCGACTAAAAAGTGCTAT
LBUL_1497 groS -65 6.7 TTAGCACTTGATCAAGATGAGTGCTAA
Lactobacillus fermentum IFO 3956
LAF_0749 hrcA -33 6.4 TTAGCACTTAGATGGCCAGAGTGCTAA
LAF_0325 groS -87 5.7 TTAGCACTTGAGGGGGTTGAGTGCTAG
LAF_0360 clpP -44 5.5 TTAGCAAACAGTACTAACTAGTGCTAA
LAF_1388 clpL -190 5.6 TTAGCATTAGTTGCCAATCAGTGCTAA
Lactobacillus helveticus DPC 4571
lhv_0683 clpL -71 6.7 TTAGCACTTGACTACTAAGAGTGCTAA
lhv_0425 groS -159 6.9 TTAGCACTATTTGTAAAAAAGTGCTAA
lhv_0735 clpP -60 6.6 TTAGCACAGTACTTAAAAGAGTGCTAA
lhv_0222 hsp -130 6.1 TTAGCACTATATGCTTTTGAATGCTAA
lhv_2043 clpC -59 5.9 TTAGCACTTGAAGGCTTTAAGTGCTAA
lhv_0425 groS -85 7.1 TTAGCACTTAAGAAATAAGAGTGCTAA
Lactobacillus johnsonii NCC 533
LJ1481 hrcA -91 6.4 TTAGCACTCTACTTGAACAATTGCTAA
LJ0815 clpL -70 7.6 TTAGCACTCATATATCAAGAGTGCTAA
LJ0869 clpP -49 6.9 TTAGCACTGTACTTATTAGAGTGCTAA
LJ0181 hsp -78 5.9 TTAGCACCGTTCTAATTAGTGTGCTAA
LJ1775 clpC -58 6.7 TTAGCACTTATAACTTATGAGTGCTAA
LJ0460 groS -70 7 TTAGCACTTATAATATATGAGTGCTAA
LJ0460 groS -155 6.9 TTAGCACTCTGATGATAAAAGTGCTAA
LJ1481 hrcA -43 6.3 TTAGCACAGAAGAAAGAAGAGTGCTAA
Lactobacillus plantarum WCFS1
lp_2029 hrcA -191 7.1 TTAGCACTCGTAAGTAAGGAGTGCTAA
lp_0129 hsp -149 7.5 TTAGCACTCGAGTTAAACGAGTGCTAA
lp_0727 groS -51 6.4 TTAGCACTTGAGGTTGAGGAGTGCTAA
lp_2029 hrcA -36 6.7 TTAGCACTCCATTAAGTTAAGTGCTAA
Lactobacillus reuteri JCM 1112
LAR_0342 groS -61 6.5 TTAGCACTTGAAGAGTTTGAGTGCTAA
LAR_1257 clpL -211 6.9 TTAGCATTCATGGCTAAAGAGTGCTAA
LAR_0379 clpP -47 5.8 TTAGCATATAAGACTAACGAGTGCTAA
LAR_0677 hrcA -45 6.5 TTAGCACTTGACCCTAATGAGTGCTAA
Lactobacillus rhamnosus GG
LGG_01823 clpL -128 6.2 TTAGCACTCTTGCGGTTAGAGTGCTTG
LGG_01606 hrcA -42 7.6 TTAGCACTCGTGTAAAACGAGTGCTAA
LGG_02804 hsp -97 7.1 TTAGCACTCTAACATGACGAGTGCTAA
LGG_00931 clpP -54 7 TTAGCACTGTACTTTAAAGAGTGCTAA
LGG_02240 groS -56 6.6 TTAGCACTTAGACACAACGAGTGCTAA
Lactobacillus sakei subsp. sakei 23K
LSA0358 groS -55 6.8 TTAGCACTTGAGTGTTTAGAGTGCTAA
LSA0050 hsp -96 7.7 TTAGCACTCGTGATAAAAGAGTGCTAA
LSA1238 hrcA -41 7 TTAGCACTCGTAATAATCAAGTGCTAA
LSA0207 clpC -121 5.9 GTGGCACTTTTCTTGCTAGAGTGCTAA
Lactobacillus salivarius subsp. salivarius UCC118
LSL_0576 hrcA -41 6.6 TTAGCACTCTAATGTGTTAAGTGCTAA
LSL_1212 groS -61 7 TTAGCACTCAAGAGTTGAGAGTGCTAA
LSL_1212 groS -135 6.4 TTAGCACTCTAATGTGTCGAGTGATAA
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
LEUM_0571 clpL -151 7.6 TTAGCACTCTACTTTAAAGAGTGCTAA
LEUM_1763 groS -54 7.5 TTAGCACTCACGTTTAAAGAGTGCTAA
LEUM_1349 hrcA -41 6.3 TTAGCAGTTAGATATAGTGAGTGCTAA
LEUM_1349 hrcA -110 7.4 TTGGCACTCTTATAAAAAGAGTGCTAA
LEUM_0396 clpP -81 6.4 TTAGCACTCTCGTCTCTAATGTGCTAA
Pediococcus pentosaceus ATCC 25745
PEPE_0894 hrcA -41 6.4 TTAGCACTCCAACTTTCTAAGTGCTAA
PEPE_0976 clpC -122 6.9 TTAGCACTTTACTTAACAGAGTGCTAA
PEPE_0420 groS -65 6.3 TTAGCACTTAGAGATGACGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD