Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RegR in Streptococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptococcus agalactiae 2603V/R
SAG1904 kduD -265 5.1 TGAGTTTACCGGTTTACTTT
SAG1904 kduD -46 5.1 CATGTAAACAGGTTTACTTC
SAG1904 kduD -75 5.9 TGACAAAACCGGTTTACTTT
SAG1197 hyl -42 5 AGGAAAAACCGGTTTACAAT
SAG1902 hylD -32 5.1 AAAGTAAACCGGTAAACTCA
SAG1902 hylD -251 5.1 GAAGTAAACCTGTTTACATG
SAG1902 hylD -222 5.9 AAAGTAAACCGGTTTTGTCA
Streptococcus dysgalactiae subsp. equisimilis GGS_124
SDEG_0648 hylD -33 5.3 TAAGTAAACCGGTAAACTAA
SDEG_0648 hylD -280 5.1 AAAGTAAACTAGTTTTGTCA
SDEG_0650 kduD -74 5.1 TGACAAAACTAGTTTACTTT
SDEG_0650 kduD -45 6.1 TTGGTAAACAGGTTTACTTA
Streptococcus equi subsp. zooepidemicus MGCS10565
Sez_1304 hylD -281 6.1 TAAGTAAACCTGTTTACCAA
Sez_1303 kduD -293 5.3 TTAGTTTACCGGTTTACTTA
Sez_1303 kduD -45 6.1 TTGGTAAACAGGTTTACTTA
Sez_1304 hylD -33 5.3 TAAGTAAACCGGTAAACTAA
Streptococcus pneumoniae TIGR4
SP_0314 hyl -89 6.2 TAATTAAACCGGTTTACTTA
SP_0320 kduD -253 5 TAGGTTTACCGGTTTACTTT
SP_0320 kduD -71 5.6 TGACAAAACCGGTTTACTAG
SP_0321 hylD -219 5.6 CTAGTAAACCGGTTTTGTCA
SP_0321 hylD -37 5 AAAGTAAACCGGTAAACCTA
Streptococcus pyogenes M1 GAS
SPy0636 kduD -45 6.1 TTGGTAAACAGGTTTACTTA
SPy0636 kduD -74 5.1 TGACAAAACTAGTTTACTTT
SPy1032 hyl -54 5.5 TTAGTAAATCAATTTACTTT
SPy0634 hylD -33 4.6 TGAGTAAACCGGTAAACCGA
SPy0634 hylD -281 5.1 AAAGTAAACTAGTTTTGTCA
Streptococcus suis 05ZYH33
SSU05_1225 kduD -75 5.8 TGACAAAACCGGTTTACTAT
SSU05_1221 hylD -33 4.9 TAGGTAAACCGGTAAAGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD