Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Mycobacteriaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium leprae TN
ML1224 nrtR -23 7.6 GTTTTCGACTTATAATCGAAAAC
ML1225 nadA -46 7.6 GTTTTCGATTATAAGTCGAAAAC
Mycobacterium marinum M
MMAR_2390 nrtR -23 7.5 GTTTTCGACTTACAATCGAAAAC
MMAR_2391 nadA -47 7.5 GTTTTCGATTGTAAGTCGAAAAC
Mycobacterium smegmatis str. MC2 155
MSMEG_3198 nrtR -50 7.6 GTTTTCGACTTATAATCGAAAAC
MSMEG_3199 nadA -46 7.6 GTTTTCGATTATAAGTCGAAAAC
Mycobacterium sp. JLS
Mjls_3085 nadA -46 7.5 GTTTTCGATTGTAAGTCGAAAAC
Mjls_3086 nrtR -23 7.5 GTTTTCGACTTACAATCGAAAAC
Mycobacterium tuberculosis H37Rv
Rv1593c nrtR -23 7.6 GTTTTCGACTTATAATCGAAAAC
Rv1594 nadA -48 7.6 GTTTTCGATTATAAGTCGAAAAC
Mycobacterium vanbaalenii PYR-1
Mvan_2798 nadA -47 7.5 GTTTTCGATTGTAAGTCGAAAAC
Mvan_2797 nrtR -23 7.5 GTTTTCGACTTACAATCGAAAAC
Mycobacterium flavescens PYR-GCK
Mflv_3619 nadA -47 7.5 GTTTTCGATTGTAAGTCGAAAAC
Mflv_3620 nrtR -23 7.5 GTTTTCGACTTACAATCGAAAAC
Mycobacterium avium 104
MAV_3191 nadA -46 7.6 GTTTTCGATTATAAGTCGAAAAC
MAV_3192 nrtR -62 7.6 GTTTTCGACTTATAATCGAAAAC
Mycobacterium abscessus ATCC 19977
MAB_2675 nrtR -23 7.1 GTTTTCGACTTATGATCGAAAAC
MAB_2674c nadA -82 7.1 GTTTTCGATCATAAGTCGAAAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD