Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Fur in Shewanellaceae

Properties
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO1188 null -185 5.4 TTTTGATAATAAATATCATTT
SO0744 fbpA -76 5.7 AACTGATAACTATTATCATTA
SO0447 null -146 5.2 TATTGCGAACTATTCTCATCA
SO0583 bfd -55 5.3 ATTTGATAAGCGTTTTCATTT
SO1111 bfr2 -125 5.2 TAATGAGAATGCTTTTAATTA
SO0139 ftn -133 5.7 AAATGAAAATCATTTTTATCA
SO4740 null -60 6 TAATGAGAATTGTTATCATCT
SO3062 null -67 5.5 TGTTGAGAACAATTCTCATCT
SO1783 feoA -121 5.4 AATTGAAAACTATTATCGTTA
SO1782 mtrD -370 5.4 TAACGATAATAGTTTTCAATT
SO3030 pubA -208 5.7 AGATGAGAACGATTTGCATTT
SO1779 omcA -64 5.6 TAATGAGATTTGTTCTTATTT
SO3669 hmuA -169 5.7 AAATGATAATGATTTCTATTT
SO3670 tonB -97 5.7 AAATAGAAATCATTATCATTT
SO4423.1 SO4423.1 -98 5.4 TAATAAAAATCGTTACCATTT
SO3344 null -44 6 AAATGATAATGATTATCAGTT
SO4743 null -116 5.7 AAATAAAAACAATTCTTATTT
SO4700 null -86 5.3 AAATCAAATCCATTCTCATTA
SO3914 null -108 5.1 AAATGATAATAATTATTGATC
SO2841 null -60 5.4 GACTGATAATAGTTTTCATTT
SO2426 null -2 5.6 AAATGATATTGATTCTCGTTT
SO0798 null -62 6.1 AAATAATAACAATTCTCATTT
SO1482 null -49 5 GGATGGAAATCATTATCATTC
SO1580 null -82 5.5 ATGTGAGAATTATTCTCATCT
SO1755 null -30 5.3 AATTGAAAATGATTTTCACTG
SO2039 null -44 5.6 AAATGCGAATAATTAGCAATT
SO3025 null -220 5.8 AAATGACAATAGTTGTCATTT
SO3406 null -273 5.7 AAATGATATTGTTTATCATTT
SO4516 viuA -100 5.8 AAATGATATTGGTTATCAATT
SO_4523 irgA -50 6.1 TATTGAAAATTATTATCATTT
SO3371 null -59 4.7 TTATGATAATGAACATTATTT
SO0719 null -40 4.9 AGGTAGGAACAATTCTCATTT
Shewanella putrefaciens CN-32
Sputcn32_1997 Sfri_2008 -63 5.9 TGTTGATAATAATTATCATTT
Sputcn32_3953 null -68 5.6 AAATAAAAACACTTCTCATTT
Sputcn32_0132 ftn -131 5.7 AAATGAAAATCATTTTTATCA
Sputcn32_0948 bfr2 -126 5.5 AAATGAGAATGGTTTTTATAA
Sputcn32_3227 fbpA -74 5.8 AAGTGATAACTATTATCATTA
Sputcn32_3863 null -21 5.3 AAATGAAAACTATTCGTAATA
Sputcn32_1826 null -48 5.1 CATTAAGAATAATTATCATTC
Sputcn32_0966 hmuA -178 6.1 AAATGATAATGATTACCATTT
Sputcn32_2436 null -55 5.5 AATTGAGAACCATTCTCAACA
Sputcn32_3397 null -184 5.2 TATTGCGAATTGTTATCAATA
Sputcn32_2850 null -93 5.2 GTTTGATAATAAATATCATTT
Sputcn32_3921 null -59 6 TAATGAGAATTGTTATCATCT
Sputcn32_3295 bfd -54 5.3 ATTTGATAAGCGTTTTCATTT
Sputcn32_1479 omcA3 -64 5.7 TAATGAGATTAATTCTTATTT
Sputcn32_1480 feoA -123 5.4 AATTGAAAACTATTATCGTTA
Sputcn32_2411 pubA -219 6 AAATGATAACGATTTGCATTT
Sputcn32_1841 null -85 5.2 TAATACGAATTGTTATCAATA
Sputcn32_1841 null -59 5.7 TATTGATAATTGTTTTCAATT
Sputcn32_1590 null -101 6 AAATGAGAATTATTGTCATCT
Sputcn32_3671 null -54 5.7 AATTGATAACTATTCTCATTG
Sputcn32_3636 null -77 5.3 TAATGTTAATCATTATCATTC
Sputcn32_0401 SO4423.1 -97 5.6 TAACGAAAATCGTTATCATTT
Sputcn32_2679 null -40 6 AGATGATAATGATTATCAATT
Sputcn32_0964 exbB -31 5.2 AAATGATAATTATCATGATTA
Sputcn32_0965 tonB -75 6.1 AAATGGTAATCATTATCATTT
Sputcn32_1842 COG3182 -90 5.7 AATTGAAAACAATTATCAATA
Sputcn32_1842 COG3182 -64 5.2 TATTGATAACAATTCGTATTA
Sputcn32_0603 Sden_3064 -91 5.1 AAATAACAATAACTATCATTA
Sputcn32_1941 null -2 5.5 AAATGATATCGATTCTCGTTT
Sputcn32_1534 null -59 5.6 GACTGATAATAATTTTCATTT
Sputcn32_3191 null -62 5.6 AAATAATAACCATTCTCATTC
Sputcn32_1237 null -49 4.7 AAATACAAATCATTACTATTC
Sputcn32_1308 null -84 5.6 AATTGAGAACTATTCTTATCT
Sputcn32_1454 null -30 4.8 GATTGCAAATGATTTTCAATG
Sputcn32_2106 null -48 4.9 AAATGCAAATAATAAGCAATT
Sputcn32_2727 null -196 5.5 AAATGATATCGTTTATCATTT
Sputcn32_0330 viuA -101 5.6 AAATGATAATCCTTCTCAGTT
Sputcn32_3503 null -52 5.9 TATTGAAAATTGTTCTCATTT
Sputcn32_0603 null -91 5.1 AAATAACAATAACTATCATTA
Sputcn32_3181 Sbal_0657 -101 5.8 TAACGATAATTATTATCATTT
Sputcn32_2703 null -60 4.6 TTATGATAATGGATATTGTTT
Shewanella sp W3-18-1
Sputw3181_0546 null -182 5.2 TATTGCGAATTGTTATCAATA
Sputw3181_0714 fbpA -74 5.8 AAGTGATAACTATTATCATTA
Sputw3181_4050 null -68 5.6 AAATAAAAACACTTCTCATTT
Sputw3181_3940 ftn -131 5.7 AAATGAAAATCATTTTTATCA
Sputw3181_0090 null -21 5.3 AAATGAAAACTATTCGTAATA
Sputw3181_2183 null -48 5.1 CATTAAGAATAATTATCATTC
Sputw3181_3202 tonB -75 6.1 AAATGGTAATCATTATCATTT
Sputw3181_3201 hmuA -178 6.1 AAATGATAATGATTACCATTT
Sputw3181_1054 null -93 5.2 GTTTGATAATAAATATCATTT
Sputw3181_4047 null -59 6 TAATGAGAATTGTTATCATCT
Sputw3181_0646 bfd -54 5.3 ATTTGATAAGCGTTTTCATTT
Sputw3181_2621 feoA -123 5.4 AATTGAAAACTATTATCGTTA
Sputw3181_1597 pubA -219 6 AAATGATAACGATTTGCATTT
Sputw3181_3228 bfr2 -126 5.5 AAATGAGAATGGTTTTTATAA
Sputw3181_2168 null -85 5.2 TAATACGAATTGTTATCAATA
Sputw3181_2168 null -59 5.7 TATTGATAATTGTTTTCAATT
Sputw3181_2432 null -101 6 AAATGAGAATTATTGTCATCT
Sputw3181_3812 null -53 5.7 AATTGATAACTATTCTCATTG
Sputw3181_3776 null -77 5.3 TAATGTTAATCATTATCATTC
Sputw3181_0255 SO4423.1 -97 5.6 TAACGAAAATCGTTATCATTT
Sputw3181_2622 omcA3 -64 5.7 TAATGAGATTAATTCTTATTT
Sputw3181_1332 null -40 6 AGATGATAATGATTATCAATT
Sputw3181_3203 exbB -31 5.2 AAATGATAATTATCATGATTA
Sputw3181_2167 COG3182 -90 5.7 AATTGAAAACAATTATCAATA
Sputw3181_2167 COG3182 -64 5.2 TATTGATAACAATTCGTATTA
Sputw3181_3569 Sden_3064 -91 5.1 AAATAACAATAACTATCATTA
Sputw3181_2064 null -2 5.5 AAATGATATCGATTCTCGTTT
Sputw3181_2565 null -59 5.6 GACTGATAATAATTTTCATTT
Sputw3181_0752 null -62 5.6 AAATAATAACCATTCTCATTC
Sputw3181_2867 null -49 4.7 AAATACAAATCATTACTATTC
Sputw3181_2795 null -84 5.6 AATTGAGAACTATTCTTATCT
Sputw3181_2648 null -30 4.8 GATTGCAAATGATTTTCAATG
Sputw3181_1906 null -48 4.9 AAATGCAAATAATAAGCAATT
Sputw3181_1285 null -196 5.5 AAATGATATCGTTTATCATTT
Sputw3181_3878 viuA -101 5.6 AAATGATAATCCTTCTCAGTT
Sputw3181_0403 null -52 5.9 TATTGAAAATTGTTCTCATTT
Sputw3181_3569 null -91 5.1 AAATAACAATAACTATCATTA
Sputw3181_0762 Sbal_0657 -101 5.8 TAACGATAATTATTATCATTT
Sputw3181_1308 null -60 4.6 TTATGATAATGGATATTGTTT
Shewanella sp ANA-3
Shewana3_1202 null -44 6.1 AAATGATAATGATTATCACTT
Shewana3_1014 null -181 5.6 TGTTGATAATAAATATCATTT
Shewana3_3517 fbpA -76 5.7 AACTGATAACTATTATCATTA
Shewana3_0445 null -152 5.1 TATTGCGAACTGTTCTCATCA
Shewana3_0952 null -63 5.2 AAATGCAAATCGTTCTCAATG
Shewana3_0132 ftn -132 5.7 AAATGAAAATCATTTTTATCA
Shewana3_4124 null -60 6 TAATGAGAATTGTTATCATCT
Shewana3_1485 null -67 5.8 AGTTGAGAATAATTCTCATCT
Shewana3_2671 feoA -121 5.4 AATTGAAAACTATTATCGTTA
Shewana3_2672 mtrD -326 5.4 TAACGATAATAGTTTTCAATT
Shewana3_2675 omcA -64 5.3 TAATGAGATTTATTCTTATTC
Shewana3_1510 pubA -224 6.1 AAATGAGAATGATTTGCATTT
Shewana3_0946 bfr2 -125 5.4 TAATGAGAATGCTTTTTATCT
Shewana3_3235 hmuA -171 6 AAATGATAATGATTTCCATTT
Shewana3_2551 null -99 6 AAATGAGAATTATTGTCATCT
Shewana3_0299 Shewmr4_0304 -194 5.6 AATTAATAACAATTCTCAATT
Shewana3_3236 tonB -98 6 AAATGGAAATCATTATCATTT
Shewana3_1861 null -47 5.2 ATTTAAGAATAATTATCATTC
Shewana3_0286 SO4423.1 -98 5.5 CAATAAAAATCGTTATCATTT
Shewana3_4127 null -68 5.7 AAATAAAAACAATTCTTATTT
Shewana3_2196 COG3182 -66 5.5 TATTGATAACAATTCGCATTA
Shewana3_0716 null -107 5.5 AAATGATAATAATTATTGATT
Shewana3_2609 null -71 5.6 GACTGATAATAATTTTCATTT
Shewana3_1959 null -32 5.6 AAATGATATTGATTCTCGTTT
Shewana3_2944 null -48 5.8 AGATGAAAATCATTATCATTC
Shewana3_2862 null -81 5.6 AGGTGAGAATTATTCTCATCT
Shewana3_2707 null -30 4.9 GATTGAAAATGATTTTCACTG
Shewana3_2237 null -44 5 AAATGCGAATAATTAGCGATT
Shewana3_1514 null -177 5.8 GAATGATAATAATTGTCATTT
Shewana3_1149 null -177 5.7 AAATGATATTGTTTATCATTT
Shewana3_3923 viuA -99 5.8 AAATGATATTGGTTATCATCT
Shewana3_3929 null -49 6.1 TATTGAAAATTATTATCATTT
Shewana3_0919 Sama_2655 -84 4.9 TAATGATAATGATTTGCGTTG
Shewana3_1178 null -59 5 TTATGATAATGACTATTATTT
Shewana3_0581 bfd -54 5.3 ATTTGATAAGCGTTTTCATTT
Shewana3_4052 null -86 4.8 AAATCGAATCCATTCTCATTA
Shewanella sp MR-4
Shewmr4_0449 null -153 4.8 TATTGCGAACTATTCTCACCA
Shewmr4_3347 fbpA -76 5.7 AACTGATAACTATTATCATTA
Shewmr4_3843 null -27 5.3 AAATCAAATCCATTCTCATTA
Shewmr4_3922 null -68 5.7 AAATAAAAACAATTCTTATTT
Shewmr4_0133 ftn -132 5.4 AAATGCAAATCATTTTTATCA
Shewmr4_0950 null -57 5.6 AAATGCAAATCGTTCTCAATA
Shewmr4_1806 null -47 5.2 ATTTAAGAATAATTATCATTC
Shewmr4_0582 bfd -54 5.3 ATTTGATAAGCGTTTTCATTT
Shewmr4_1201 null -44 6.1 AAATGATAATGATTATCACTT
Shewmr4_3919 null -60 6 TAATGAGAATTGTTATCATCT
Shewmr4_1432 null -66 6 AATTGAGAATGATTCTCATCT
Shewmr4_2506 mtrD -326 5.4 TAACGATAATAGTTTTCAATT
Shewmr4_2509 omcA -64 5.7 TAATGAGATTTATTCTTATTT
Shewmr4_2505 feoA -121 5.4 AATTGAAAACTATTATCGTTA
Shewmr4_1454 pubA -222 5.9 AAATGAGAATGGTTTGCATTT
Shewmr4_0944 bfr2 -124 5.4 TAATGAGAATGCTTTTTATCT
Shewmr4_2386 null -98 6.2 AAATGAGAATTATTGTCATTT
Shewmr4_0304 Shewmr4_0304 -193 5.1 AATTAAGAACGATTCTCGATT
Shewmr4_0531 null -145 5.7 AAATGATAATTATTTACATTA
Shewmr4_0286 SO4423.1 -98 5.5 CAATAAAAATCGTTATCATTT
Shewmr4_1010 null -181 5.6 TGTTGATAATAAATATCATTT
Shewmr4_2076 COG3182 -65 5.5 TATTGATAACAATTCGCATTA
Shewmr4_3245 null -106 5.5 AAATGATAATAATTATTGATT
Shewmr4_1904 null -32 5.6 AAATGATATTGATTCTCGTTT
Shewmr4_2447 null -71 5.6 GACTGATAATAATTTTCATTT
Shewmr4_3318 null -62 6.2 AAATAATAATTATTCTCATTT
Shewmr4_2768 null -48 5.8 AGATGAAAATCATTATCATTC
Shewmr4_2541 null -30 4.9 GATTGAAAATGATTTTCACTG
Shewmr4_2112 null -42 5 AAATGCGAATAATTAGCGATT
Shewmr4_1148 null -177 5.7 AAATGATATTGTTTATCATTT
Shewmr4_3727 viuA -99 6 AAATGATATTGGTTATCATTT
Shewmr4_2003 Sfri_2008 -59 5.7 TGTTGATAACTATTCTCATTT
Shewmr4_0630 Sama_0590 -62 5 TAACGAGAATAATTCTTGTTT
Shewmr4_0920 Sama_2655 -84 4.9 TAATGATAATGATTTGCGTTG
Shewmr4_1177 null -59 5 TTATGATAATGACTATTATTT
Shewanella sp MR-7
Shewmr7_1272 null -44 6.1 AAATGATAATGATTATCACTT
Shewmr7_0606 fbpA -76 5.7 AACTGATAACTATTATCATTA
Shewmr7_3580 null -155 4.8 TATTGCGAACTATTCTCACCA
Shewmr7_0127 ftn -132 5.4 AAATGCAAATCATTTTTATCA
Shewmr7_0988 null -57 5.6 AAATGCAAATCGTTCTCAATA
Shewmr7_2171 null -47 5.2 ATTTAAGAATAATTATCATTC
Shewmr7_4014 null -68 5.7 AAATAAAAACAATTCTTATTT
Shewmr7_4011 null -60 6 TAATGAGAATTGTTATCATCT
Shewmr7_1497 null -66 5.8 AGTTGAGAATTATTCTCATCT
Shewmr7_3448 bfd -54 5.3 ATTTGATAAGCGTTTTCATTT
Shewmr7_2573 feoA -121 5.4 AATTGAAAACTATTATCGTTA
Shewmr7_2574 mtrD -326 5.4 TAACGATAATAGTTTTCAATT
Shewmr7_2577 omcA -64 5.7 TAATGAGATTTATTCTTATTT
Shewmr7_1520 pubA -223 5.9 AAATGAGAATGGTTTGCATTT
Shewmr7_0982 bfr2 -125 5.4 TAATGAGAATGCTTTTTATCT
Shewmr7_2458 null -98 5.5 AAATGAGAATTATTGTCACCT
Shewmr7_3720 Shewmr4_0304 -192 5.1 AATTAAGAACGATTCTCGATT
Shewmr7_3500 null -145 5.7 AAATGATAATTATTTACATTA
Shewmr7_3733 SO4423.1 -98 5.5 CAATAAAAATCGTTATCATTT
Shewmr7_1075 null -181 5.6 TGTTGATAATAAATATCATTT
Shewmr7_1899 COG3182 -65 5.5 TATTGATAACAATTCGCATTA
Shewmr7_0697 null -106 4.8 AAATGATAATAATAATTGATT
Shewmr7_2074 null -32 5.6 AAATGATATTGATTCTCGTTT
Shewmr7_2517 null -71 5.6 GACTGATAATAATTTTCATTT
Shewmr7_0635 null -62 6.2 AAATAATAATTATTCTCATTT
Shewmr7_2846 null -48 5.8 AGATGAAAATCATTATCATTC
Shewmr7_2608 null -31 4.9 GATTGAAAATGATTTTCACTG
Shewmr7_1862 null -44 5.6 AAATGCGAATAATTAGCAATT
Shewmr7_1219 null -177 5.7 AAATGATATTGTTTATCATTT
Shewmr7_3798 viuA -99 6 AAATGATATTGGTTATCATTT
Shewmr7_1972 Sfri_2008 -59 5.7 TGTTGATAACTATTCTCATTT
Shewmr7_3399 Sama_0590 -62 5 TAACGAGAATAATTCTTGTTT
Shewmr7_0955 Sama_2655 -84 4.9 TAATGATAATGATTTGCGTTG
Shewmr7_1248 null -59 5 TTATGATAATGACTATTATTT
Shewmr7_3936 null -27 5.3 AAATCAAATCCATTCTCATTA
Shewanella baltica OS155
Sbal_0812 fbpA -76 5.4 AACTGATAAGCATTATCATTA
Sbal_0123 null -86 4.5 AAATCGAATCAATTCGCATTA
Sbal_4484 Sfri_2008 -63 5.6 TGTTGATAACAGTTATCATTT
Sbal_4484 Sfri_2008 -165 4.7 AAATAAAAATAATGATCACAT
Sbal_2198 Sfri_2008 -63 5.6 TGTTGATAACAGTTATCATTT
Sbal_4363 null -68 5.6 AAATAAAAACACTTCTCATTT
Sbal_4222 ftn -131 5.7 AAATGAAAATCATTTTTATCA
Sbal_2136 null -63 4.8 AAATAAAAGTGATTCGCAATA
Sbal_2423 null -47 5.2 ATTTAAGAATAATTATCATTC
Sbal_0952 hmuA -284 6.1 AAATGATAATGATTTGCATTT
Sbal_3017 null -41 6 AGATGATAATGATTATCAATT
Sbal_2737 null -50 5.2 AATTGCGAATAGTTCTCAACA
Sbal_3255 null -45 5.4 ATTTGATAATCGATCTCATTT
Sbal_4341 null -59 6 TAATGAGAATTGTTATCATCT
Sbal_0542 bfd -53 5.3 ATTTGATAAGCGTTTTCATTT
Sbal_1593 mtrD -335 5.4 TAACGATAATAGTTTTCAATT
Sbal_1590 omcA -64 5.5 TAATGAGATTTATTCTTATCT
Sbal_1594 feoA -121 5.4 AATTGAAAACTATTATCGTTA
Sbal_2708 pubA -232 6.1 AAATGAGAATGATTTGCATTT
Sbal_0932 bfr2 -126 5.3 AAATGAGAATGGTTGTTATCA
Sbal_0951 tonB -63 6.1 AAATGCAAATCATTATCATTT
Sbal_0298 SO4423.1 -100 5.6 GAATAAAAATCGTTATCATTT
Sbal_2198 Sfri_2008 -165 4.7 AAATAAAAATAATGATCACAT
Sbal_2134 COG3182 -64 5.4 TATTGATAACAATTTGCATTA
Sbal_3635 null -108 4.9 AAATGATAATAGTTATTGATC
Sbal_2050 null -32 5.1 AAATGATATAGATTCTCGTTT
Sbal_1657 null -63 5.4 GACTGATAATAGTTTTCATTT
Sbal_1315 null -49 5 AAATGCAAATCATTACTATTC
Sbal_1397 null -84 5.4 AAGTGAGAACTATTCTTATCT
Sbal_1561 null -30 4.8 GATTGCAAATGATTTTCAATG
Sbal_4560 null -46 5.3 AAATGCGAATAATTAGTATTA
Sbal_2274 null -46 5.3 AAATGCGAATAATTAGTATTA
Sbal_1237 null -195 5.5 AAATGATATCGTTTATCATTT
Sbal_0217 null -52 5.9 TATTGAAAATTGTTCTCATTT
Sbal_0657 Sbal_0657 -101 5.8 TAACGATAATTATTATCATTT
Sbal_0904 Sama_2655 -83 4.8 TAATGATAACGATTTGCGTTG
Sbal_3042 null -61 5.3 TTATGATAATGAATATTATTT
Sbal_2014 Sfri_4035 -93 5.4 AAATGCGAATTGTTTGCATTA
Shewanella denitrificans OS217
Sden_0638 Sfri_4035 -91 5.1 AAATACGAATAGTTTGCATTA
Sden_3594 null -123 4.7 AAATAAGACTGGTTTGTATTT
Sden_1854 Sfri_2008 -36 6 AAATAAAAACCATTCTCATTT
Sden_3064 null -122 6.2 AAATAATAATGATTATCATTT
Sden_0590 Sden_0590 -63 5 TAATGAAAATCATTACCAGTC
Sden_0721 Sfri_0810 -74 5.8 TAATGCAAATTGTTATCATTT
Sden_0590 Sden_0590 -69 5.3 AAATGATAATGAAAATCATTA
Sden_0990 bfr2 -120 5.6 TAATGATAATGGTTATCACTA
Sden_0620 null -72 5.2 AATTGCAAATCACTCTCATTT
Sden_2159 null -58 5.8 TATTGAGATTCATTATCATTT
Sden_3706 null -50 6 TATTGATAACGATTATCATTT
Sden_3217 bfd -99 5.7 CAATGATAACCGTTTTCATTT
Sden_0790 hmuA -133 6.5 AAATGATAATGATTTTCATTT
Sden_2415 feoA -116 5.4 AATTGAAAACTATTATCGTTA
Sden_0609 Sfri_3851 -101 5.3 AAACGCTAACAATTCTCATTA
Sden_3064 Sden_3064 -122 6.2 AAATAATAATGATTATCATTT
Sden_1906 null 10 5.6 TAATGAAAATGGTTATCGTTT
Sden_1445 null -48 5.2 CTATGATAATCATTATCATTC
Sden_2503 null -172 5.5 AACTGATAATCATTCTCATTG
Sden_1592 null -44 5.2 AAATAGGAATAATTAGCATTA
Sden_2355 null -75 5.2 GAATAAAAACAGTTCTCAATT
Sden_0621 viuA -92 5.2 AAATGAGAGTGATTTGCAATT
Sden_0789 tonB -66 6.5 AAATGAAAATCATTATCATTT
Shewanella frigidimarina NCIMB 400
Sfri_4035 Sfri_4035 -106 5.6 TAATGATAATGGTTTGCATTA
Sfri_3875 null -80 5.3 AAACGAGACTGATTATCATTT
Sfri_2008 Sfri_2008 -116 6 AATTGATAACTATTCTCATTA
Sfri_3717 null -90 5.7 AAATGATAATGATTTCTATTT
Sfri_0810 Sfri_0810 -78 5.6 TAATGCGAATCGTTATCAATT
Sfri_4042 null -68 5.4 AAATGGAAACGCTTCTCATTT
Sfri_0636 fbpA -67 5.9 AATTGATAACCATTATCAATT
Sfri_3225 omp -102 5 GATTGATAATCGTTGTTATTA
Sfri_4031 null -46 6 TAATGAGAACTGTTATCATTT
Sfri_3324 bfd -76 5.7 CAATGATAACCGTTTTCATTT
Sfri_2617 feoA -111 5.1 AACTGAAAACTATTCTCGTTA
Sfri_0391 null -75 5.7 AAATGAGAATAGTTTCCATTA
Sfri_0392 SO4423.1 -54 5.9 TAATGATAATGAATATCATTA
Sfri_0957 bfr2 -121 6 TAATGATAATAGTTATCAATT
Sfri_0202 Sfri_0202 -48 6 TAATGCAAATCATTATCATTT
Sfri_2548 COG3182 -184 5.6 TATTGCTAATGATTATCATTA
Sfri_2548 COG3182 -107 5.5 AATTGATAATAATTATCACTC
Sfri_2548 COG3182 -80 5 TATTGAGATTCGTTATCAATC
Sfri_2549 Sden_3064 -195 5 GATTGATAACGAATCTCAATA
Sfri_2549 Sden_3064 -168 5.5 GAGTGATAATTATTATCAATT
Sfri_2549 Sden_3064 -91 5.6 TAATGATAATCATTAGCAATA
Sfri_3717 Sden_3064 -90 5.7 AAATGATAATGATTTCTATTT
Sfri_2150 null -32 5.6 TAATGGTAATCGTTATCATTA
Sfri_2440 null -52 5.6 TTATGATAATCATTATCATTC
Sfri_2159 null -30 5.4 TATTGAAAATGATTATCAATG
Sfri_2549 null -91 5.6 TAATGATAATCATTAGCAATA
Sfri_2549 null -195 5 GATTGATAACGAATCTCAATA
Sfri_2549 null -168 5.5 GAGTGATAATTATTATCAATT
Sfri_0611 null -103 5.8 AAATGATAATGATTTGTATTT
Sfri_3851 Sfri_3851 -309 5.8 AAATGAGAATAATTATCAAAA
Shewanella amazonensis SB2B
Sama_2808 null -73 4.8 TGGTGAGAATTACTCTCAATT
Sama_0666 fbpA -57 5.8 TAGTGATAATAATTATCATTA
Sama_0589 Sfri_4035 -84 5.1 CAATGCGAATCGTTTGCATTT
Sama_0141 ftn -113 5.1 TAATGATAAGTGTTACTATTT
Sama_3636 null -50 5.9 AAGTGATAACTATTATCATTT
Sama_1214 feoA -119 5.6 AATTGAAAATTATTATCGTTA
Sama_1213 mtrD -297 5.6 TAACGATAATAATTTTCAATT
Sama_1213 mtrD -150 4.7 AAATCAGACTAATTATTAATA
Sama_2530 bfr2 -122 4.7 CAATAAGAATAATTAGCCTTT
Sama_3040 bfd -59 5.5 TGATGAGAACGGTTTTTATTT
Sama_1394 SO4423.1 -54 5 CATTGAGAGTAATTATCATTA
Sama_2470 null -52 5.9 TATTGATAATAATTATCAATT
Sama_3641 null -73 5.9 AAATGCTAATCATTATCAATT
Sama_3412 Sden_3064 -65 6 TAATGATAATTATTTTTATTT
Sama_1270 null -60 5.4 GACTGAGAATGGTTTTCATTT
Sama_1718 null -32 4.8 GAATAACAACCGTTCGCATTT
Sama_1896 null -42 5.5 TAATGAGATTTATTTGCATTA
Sama_3409 null -72 5.8 AATTGAGAATGTTTATCATTT
Sama_1788 Sfri_2008 -52 6 ATATGATAACTATTCTCATTT
Sama_3412 null -65 6 TAATGATAATTATTTTTATTT
Sama_1866 null -40 5.6 TAATGCGAATCATTTTTATTT
Sama_0590 Sama_0590 -2 5.9 AAATGATAACTATTGTCATTA
Sama_2875 null -68 5.7 AATTGAGAATTATTCTCAACA
Sama_2655 Sama_2655 -84 5.4 TAATGCGAACTATTTTCATAT
Sama_0949 null -38 5.4 AGATGAAAACCATTCTCGTTA
Shewanella loihica PV-4
Shew_0861 fbpA -41 6.1 AATTGATAATTATTATCATTA
Shew_3658 null -83 5.3 AAATGCAACCAATTCTCATTT
Shew_2300 null -55 5.3 TGTTGAGAATCATTCTCACTA
Shew_0675 Sfri_0810 -77 6 TAATGCAAATTATTCTCATTT
Shew_0042 ftn -381 5.4 TAACGATAATTATTTGCATTT
Shew_3815 null -46 6.5 AAATGATAATAATTATCATTT
Shew_2873 bfr2 -115 4.8 GAATGAGAACGATTTTCTTTG
Shew_2519 mtrD -291 5.7 AAACGATAATAATTTTCAATT
Shew_2519 mtrD -222 5.8 AAATGAGAACCATTTTCATTG
Shew_2518 feoA -123 5.7 AATTGAAAATTATTATCGTTT
Shew_2518 feoA -192 5.8 CAATGAAAATGGTTCTCATTT
Shew_1688 SO4423.1 -72 4.9 ATATGATAATCTATATCATTC
Shew_3097 Sden_3064 -136 5.9 AAATGATAACCATTCCCATTT
Shew_3120 Sfri_4035 -84 5.7 TAATGATAATAGTTTGCATTA
Shew_1181 piuB -108 5.6 GAATGAAATTAATTCTCATTA
Shew_1146 null -43 6.3 AAATGATAATGATTATCAATT
Shew_1181 piuB -108 5.6 GAATGAAATTAATTCTCATTA
Shew_1936 null -31 6 TAATGATAACTATTATCATTA
Shew_3841 null -69 6 AAATAAAAACAATTCTCATTT
Shew_2690 null -51 6 TATTGATAATCGTTATCATTT
Shew_1240 null -63 4.5 GAATGAGAACCTATCTCAACA
Shew_0552 bfd -57 5.4 CAGTGAGAATCGTTTTCATTT
Shew_3097 null -136 5.9 AAATGATAACCATTCCCATTT
Shewanella pealeana ATCC 700345
Spea_4066 null 7 5 AAATACGAGCTATTATCATTT
Spea_3021 adhC -80 5.5 AAATGAAATCAATTATAATTT
Spea_0129 ftn -111 6 AAATGAAAACCATTATTATTT
Spea_2212 Sfri_2008 -117 6.1 TATTGATAATCATTATCATTT
Spea_3555 bfd -58 5.8 CATTGAGAATCATTTTCATTT
Spea_2697 omcA2 -67 5.3 AAATGAGAGTTGTTCTCATAT
Spea_1624 null -61 5.4 TGTTGAGAACAGTTCTCATTA
Spea_3339 null -53 5.8 ATTTGATAATAATTATCATTA
Spea_4226 null -47 5.9 AAATGAGAAGCGTTATCATTT
Spea_3095 bfr2 -116 5.4 TAATGAGAATGGTTATCTTTA
Spea_2692 mtrD -317 5.7 AAACGATAATAATTTTCAATT
Spea_2692 mtrD -252 5.1 AATTAAGAATGGTTACTATTT
Spea_3327 hmuA -143 6.5 AAATGATAATGATTTTCATTT
Spea_0844 fbpA -60 5.8 AATTGAGAATTATTATCAGTT
Spea_0977 SO4423.1 -108 5.3 AAACACTAATCATTATCATTT
Spea_1134 null -33 6.1 TAATGATAATGATTATCAATT
Spea_2691 feoA -126 5.7 AATTGAAAATTATTATCGTTT
Spea_2691 feoA -191 5.1 AAATAGTAACCATTCTTAATT
Spea_3328 tonB -206 6.5 AAATGAAAATCATTATCATTT
Spea_0712 Sfri_4035 -82 5.6 TAATGATAACGATTTGCATTA
Spea_0670 Sfri_0810 -100 5.7 TAATGTAAATCATTCTCATTT
Spea_2236 null -34 5.3 TAATGCGAATTATTCGTATTT
Spea_4236 null -69 6 AAATAAAAATAGTTCTCATTT
Spea_2627 null -104 5.5 GAACGATAATGATTTTCATTT
Spea_2930 null -51 6 TAATGATAATCGTTATCATCT
Spea_1223 null -82 5.3 GAATGAAAACAGTTATCAGTT
Spea_0713 Sama_0590 -66 5.5 AAATGATAATCAATCCCATTA
Spea_2929 null -43 5.8 AAAAGAGAATAATTCTCATTT
Shewanella halifaxensis HAW-EB4
Shal_3179 bfr2 -121 4.3 TAGTGATAATGAAAATCACTA
Shal_2783 mtrH -65 5.3 AGGTGAGAATAATTCTCATAA
Shal_3111 adhC -78 4.8 AAATGGAATTAGTTATAATCT
Shal_3649 bfd -58 5.5 CACTGAGAATCATTTTCATTT
Shal_3411 null -54 5.9 ATTTGATAATGATTATCATTT
Shal_4274 null -47 6.3 AAATGATAACCATTATCATTT
Shal_2778 mtrD -336 5.7 AAACGATAATAATTTTCAATT
Shal_3399 hmuA -144 6.5 AAATGATAATGATTTTCATTT
Shal_0897 fbpA -64 5.4 AATTGAGAATTATTATCAGTC
Shal_2195 Sfri_2008 -62 5.9 TGTTGATAATCATTCTCATTT
Shal_1179 null -44 6.1 AATTGATAATGATTATCAATT
Shal_2777 feoA -126 5.7 AATTGAAAATTATTATCGTTT
Shal_3400 tonB -207 6.5 AAATGAAAATCATTATCATTT
Shal_3528 Sfri_0810 -100 5.7 TAATGTAAATCATTCTCATTT
Shal_0192 null -87 4.4 AAATACGTCCCATTATCATTT
Shal_2220 null -34 5.6 AAATGAAAATGATTCGCATTG
Shal_4287 null -68 6 AAATAAAAATAGTTCTCATTT
Shal_2698 null -103 5.8 TAACGATAATGATTTTCATTT
Shal_3021 null -51 5.6 TAATAAGAATCGTTATCATCT
Shal_1861 null -35 5.2 TAATATAAACAATTATCATTT
Shal_1257 null -96 5.1 GAATGGAAACGGTTCTCAATT
Shal_0766 Sama_0590 -67 5.6 AAATGAGAATGAATAGCATTA
Shal_3020 null -42 5.8 AAAGGAGAATAATTCTCATTT
Shal_3179 bfr2 -88 4.3 TGTTGATATTTAACCTTATTT
Shal_4189 ftn -111 6 AAATGAAAACCATTATTATTT
Shewanella piezotolerans WP3
swp_0084 null -206 5.6 AAATGATAATTATTACGATTT
swp_3277 mtrH -67 5 AAATGAGATTTGTTCTCAAAC
swp_3069 null -102 4.3 TGATCATAATTGTTTTAAATC
swp_4927 null -86 5 AAATACAACCGATTATCATTT
swp_0167 ftn -110 6 AAATGAAAACCATTATTATTT
swp_2093 adhC -111 4.6 ATATTAGAGGGATTATCATTT
swp_0771 bfd -57 5.6 CATTGAGAATCGTTTTCATTT
swp_3985 null -48 5.9 AGTTGATAATGATTATCATTA
swp_4957 null -84 5.7 GAATGAGAATCAATATCATTT
swp_5137 null -46 6.1 AAATGATAATCGTTATCATCT
swp_0771 bfd -86 5.3 GATTGATAACTATTCTCATCA
swp_1175 bfr2 -118 5.5 TAATGATAATAATTATCTTTA
swp_3272 mtrD -339 5.7 AAACGATAATAATTTTCAATT
swp_3272 mtrD -239 5.3 AAATAGTAATGGTTATTATTT
swp_3978 hmuA -143 6.5 AAATGATAATGATTTTCATTT
swp_4107 fbpA -60 5.2 AATTGAGAACTATTATCAGCA
swp_1134 SO4423.1 -108 5.2 CAACAATAATCATTATCATTT
swp_3598 null -43 6.1 TAATGATAATGATTATCAATT
swp_3271 feoA -125 5.7 AATTGAAAATTATTATCGTTT
swp_3271 feoA -225 5.3 AAATAATAACCATTACTATTT
swp_3303 swp_3303 -155 5.2 TATTGATAGCAATTCTCATTA
swp_4049 Sfri_0810 -86 5.8 TAATGCAAATCGTTCTCATTT
swp_4138 Sfri_0202 -124 5.3 AAATGATAATGATTGCTATTA
swp_4138 Sfri_0202 -44 5.7 AAATACAAATCGTTATCATTT
swp_4367 Sfri_4035 -81 6 AAATGAGAATAATTTGCATTA
swp_2595 null -9 5.5 CAATGATAATTGTTCGCATTT
swp_5150 null -68 5.6 GAATAAAAACAATTCTCATTT
swp_3175 null -56 6.1 AATTGATAACGATTTTCATTT
swp_3568 null -51 5.8 TAATGATAATGGTTATCATCA
swp_0953 null -76 5.7 AAGTGATAATCATTATCATTC
swp_2763 null 29 5.6 TAATGTTAATAATTATCATTA
swp_3413 null -91 5.2 GAATAAAAATGGTTATCAATA
swp_0161 viuA -104 5.3 AAATGTGAATGATTCGCAATT
swp_0926 null -94 5.6 TGTTGAGATTAATTATCATTT
swp_3979 tonB -183 6.5 AAATGAAAATCATTATCATTT
swp_0160 null -456 5.3 AATTGCGAATCATTCACATTT
swp_0085 pvsA -111 5.6 AAATCGTAATAATTATCATTT
swp_0085 pvsA -271 5 GGATGCCAATTGTTCTCATTT
swp_0084 null -46 5 AAATGAGAACAATTGGCATCC
Shewanella sediminis HAW-EB3
Ssed_2230 bfr2 -137 4.6 TAATGGGAATGATTATCTCTA
Ssed_0144 null -97 5.5 AAATGGGAAGTGTTATCATTT
Ssed_4374 ftn -107 5.7 TAATGATAATTATTAGTATTT
Ssed_2208 Sfri_2008 -64 5.8 CATTGATAATCATTCTCATTT
Ssed_0782 bfd -54 5.8 CATTGAGAATCATTTTCATTT
Ssed_1531 feoA -126 5.6 AATTGAAAACTATTCTCGTTT
Ssed_4479 null -47 6.1 AGATGAGAATAGTTATCATTT
Ssed_1531 feoA -219 4.9 GAGCGATAATCATTCTCATCT
Ssed_1530 mtrD -322 5.6 AAACGAGAATAGTTTTCAATT
Ssed_1530 mtrD -229 4.9 AGATGAGAATGATTATCGCTC
Ssed_1530 mtrD -110 4.8 AGATAAAAATGTTACTCATTT
Ssed_0945 fbpA -58 5.7 GATTGATAATAATTATCATTA
Ssed_0946 fbpB -154 5.3 GAATTATAATCATTCTTATTT
Ssed_1496 SO4423.1 -51 4.9 AATCGAGAATGGTTATCATCC
Ssed_1239 null -41 5.7 TAATGATAATGATTATCAATC
Ssed_3889 Sfri_4035 -83 5.6 AAATGATAACCGTTTGCATTA
Ssed_3793 Sfri_0810 -76 5.1 TAATGCAAACGATTCGTATTT
Ssed_2316 null -34 5.5 AAATGATAACAGTTCGTATTT
Ssed_4483 null -66 6 AAATAAAAACGATTCTCATTT
Ssed_3242 null -49 5.5 AAATGCAAATCGTTATCATTC
Ssed_1517 null -67 5.3 AAATGAAAATCATTTGTAGTT
Ssed_1968 null -56 5 TAATGTGAATAATTACTATTT
Ssed_1345 null -98 5.1 GAATGAAAACGGTTATCACCT
Ssed_2007 null -38 5.1 TGGTGAGAACGATTATTATTA
Ssed_3888 Sama_0590 -84 5.5 AAATGATAACCACTCTCATTA
Ssed_3638 null -42 5.5 TAAGGATAATAATTCTCATTA
Shewanella woodyi ATCC 51908
Swoo_0123 null -85 5.2 AAATACAAAGCGTTATCATTT
Swoo_1070 Swoo_1070 -49 6.2 AAATGATATTAATTCTCATTT
Swoo_3608 bfr2 -167 4.5 AAATGATAATGCTTAATGTTA
Swoo_2977 null -70 6.3 AATTGAGAATAATTCTCATTT
Swoo_3124 omcA2 -79 4.6 GAATAAGAATCACTCTTATCT
Swoo_4887 null -50 6.3 AAATGAGAACCATTATCATTT
Swoo_4187 bfd -56 5.6 CATTGAGAATCGTTTTCATTT
Swoo_4766 ftn -176 5.7 TAATGAGAATTATTTGTATTT
Swoo_3123 feoA -125 5.6 AATTGAAAACTATTATCGTTT
Swoo_4004 hmuA -113 6.5 AAATGATAATGATTTTCATTT
Swoo_0996 fbpA -57 5.4 AATTGATAACTATTATCATCG
Swoo_0997 fbpB -79 5.5 AATTAATAATCGTTTTTATTT
Swoo_0585 IucABC -62 5.9 TAATGGGAATAATTATCATTT
Swoo_1339 null -42 6 AAATGATAATGATTATCAGTT
Swoo_3123 feoA -218 4.8 TAGTGATAATCGTTCTCACAA
Swoo_2428 Sfri_2008 -62 5.9 AGTTGATAACCATTCTCATTT
Swoo_4005 tonB -80 6.5 AAATGAAAATCATTATCATTT
Swoo_3788 Sfri_4035 -83 5.4 GAATGATAACAATTTGCATTA
Swoo_0790 Sfri_0810 -79 5.8 TAATGAAAACGATTCGCATTT
Swoo_1505 Sfri_0202 -25 5.4 AAATGATAATTATTTGTATAT
Swoo_1506 null -350 5.4 AAATGATAATTATTTGTATAT
Swoo_2294 null -36 5.4 TGTTGATAATTGTTCGCATTT
Swoo_4894 null -67 6.2 AAATAAAAATAATTCTCATTT
Swoo_3375 null -51 6 TAATGATAATCGTTATCATCT
Swoo_3151 null -66 5.2 CAATGCTAATGATTTTCAACT
Swoo_3307 null -96 5.7 AAATAAAAACCGTTCTCATTA
Swoo_2460 Sbal_0657 -120 5.8 TATTGATAATAAATATCATTT
Swoo_2596 null -48 5.6 AATTGCGAACAATTATCATTA
Swoo_3787 Sama_0590 -2 5.5 AAATGATAATCAATCCCATTA
Swoo_0946 null -81 5.9 AATTGATAATCGTTATCAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD