Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Crp in Shewanellaceae

Properties
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Regulog: Crp - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO4313 hemC -132 4.5 AAATGAGAGGTCCATCACACTT
SO3780 cydD -191 4.4 TTTATTGATCAGCATCGCATTT
SO1064 SO1064 -56 4.4 AACTGTGATTAATTTCACTCTA
SO1326 SO1326 -294 4.3 AATAGTGATTTTTATTGCAAAT
SO2727 cctA -184 4.4 TTACATGATGCAGCGCACATTT
SO0617 astC -142 4 AACTGGTATTTTGATCACAATT
SO2806 SO2806 -95 4.3 TCTTGTGAATTGAGTCACATAG
SO2858 SO2858 -105 4.8 TATTGTGAGTAAGTTCGCAAAT
SO4139 SO4139 -162 4.3 TTACATGATACGCTTCACAATG
SO0432 acnB -141 4.1 GAGTGTGACCTGATTCATACTT
SO0544 SO0544 -141 4 TTTTGTGATTTAGCGCATAACG
SO0543 SO0543 -192 3.7 CGTTATGCGCTAAATCACAAAA
SO4138 SO4138 -96 4.2 CATTGTGAAGCGTATCATGTAA
SO4126 null -92 4.1 TTAATTGACCTAAATCAAACTT
SO0324 ygbA -97 4.1 TTTTGTGCGCACCTTCATAAAT
SO3120 SO3120 -186 4.3 AAACGCGATCTTTATCACTATT
SO4743 SO4743 -164 4.9 AATTTTGATCTGTATCACGCAA
SO3403 yfiA-1 -142 4.7 TTCTTTGATAGGTCTCACATTT
SO0264 scyA -234 4 CAATTTGATATGGTTCCAATAA
SO0264 scyA -125 4.1 TGCTGAGATTCTAATCACAAAA
SO0479 mccA -111 3.8 TTTTTTGCTTTTTCTCTCATTC
SO0096 hutC -151 4.1 TTATGTGAGCTAGCTTGTATTT
SO1363 hcp -124 4.2 TAAAGTGATCTTTCTCTAAGAT
SO4699 prlC -136 4.2 AATTGAGAACTGGCTCACTTTT
SO2791 cdd -82 4.1 AAACGCGAACTAACTCGCATTT
SO4519 SO4519 -214 4.1 TTTTGTTAAGCAGATCATGTTT
SO0022 pepQ -237 4.4 CTTTGTGATACACTGCACAAAG
SO0770 mdh -47 4.3 AAATTAGATCCATGTCACACAT
SO4666 cytcB -95 4.4 AAATATTACCCCGATCACATTA
SO1415 SO1415 -135 3.8 GTATTTGAAGTAACTCACAAAG
SO3980 nrfA -149 3.9 AAGTGTGAACAACAACACTATT
SO3980 nrfA -126 4.1 CATTTTGATCTAGCGCAAACTT
SO3534 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
SO3119 null -166 4.5 AATAGTGATAAAGATCGCGTTT
SO4131 SO4131 -199 4.1 TTATGTGATTTTCACAACAACA
SO0426 lpdA -113 4.7 TATTGTGATCAGTATCAAACAC
SO0396 frdC1 -144 4 TTTTGTGATCATCTTCTAAGAG
SO0397 fdrC2 -79 3.9 ATTTGTGAGCGATATTAATTTT
SO4134 SO4134 -91 4.7 AATATTGATCCAGATCACGTTT
SO4142 SO4142 -121 3.9 GAAAGTGACACACCTCAAATAA
SO3542 phk -95 4.2 AATTTGGATGCAGAACACATTT
SO1673 ompW -161 4.4 TAGCGTGATTTGGATCTCAATG
SO3422 yfiA-2 -78 4.7 AAGTGTGATTTAACTCTCGTTT
SO1415 SO1415 -94 4 AGGTGTGACCTTTATCCCGATT
SO2427 null -319 5.1 AAGTGTGATTAAAATCACACTT
SO2222 fumB -105 4.6 AAATGTGATGTAGCCCAAAAAG
SO3553 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
SO1278 SO1278 -57 4.1 TAAAATGAACTAGATCAAAATA
SO4131 SO4131 -157 3.8 AATTGTAAATTTTTGCATATAT
SO1103 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
SO0439 SO0439 -34 4.4 ATACGTGATCTGACGCACATCA
SO2536 fadE2 -72 4.8 AATTGTGATCGCAATCAACAAA
SO0141 SO0141 -161 4.1 TTTCGTGAGCTAGATTAGATAT
SO1065 fkpA -119 4.3 TAGAGTGAAATTAATCACAGTT
SO3553 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
SO0862 serA -145 4.7 TTATGCGATATTGTTCTCATTT
SO2364 ccoN -125 4.1 AAATGTGAAGGATAACGCATTG
SO0940 cadC -246 4.3 TAATGTGAGCGAAGGCACGATA
SO1278 SO1278 -189 4 TAATGGGAGCGTCATCACACTC
SO0572 SO0572 -102 4.4 TATTTTGACTCAAGTCAAAATT
SO3613 purT -161 3.8 TAGCTTGATCAAAAACACAGTT
SO3797 SO3797 -53 4.5 TTTTGTTATACTCGTCACCTTT
SO2591 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
SO2591 ycbW -34 3.8 TGATGTGCCAGTGTTCAAATAG
SO2591 ycbW -2 3.7 TTATGTTATTATTGCCGCAAAA
SO4018 SO4018 -158 4.4 AAATGTGATTTGTATCAATATC
SO3090 SO3090 -165 4.6 AAGTGTGATCTGATTCTAACTT
SO4619 yhgI -129 3.9 AATCGTGATCACTATGGCAAAA
SO4570 SO4570 -207 4.4 ATTTGTGAGCTAGTTAGAATTA
SO4232 SO4232 -202 4.4 AAAAGTGATTTTCGTCACTAAA
SO1788 miaE -151 4.3 CTGTGTGATCAGGATCTCAGTT
SO1788 miaE -12 3.7 TTGAGTGATCCCATGCAACAAT
SO3774 SO3774 -146 4.4 TATAGTGTTGTCCGTCACATTT
SO0624 crp -174 3.5 TTAGTTGACTAATATCACTAAA
SO0608 petA -103 3.7 TAATGAGCCCCGCTTCAAACTT
SO0608 petA -132 3.7 CACTATGATCTGCTTCTAATTT
SO1613 null -75 4 TTCCTTGATTTAGCTCACACTC
SO2629 icd -199 4.1 AAATGTGATCTACACCTAAATG
SO3537 rpsT -225 4.5 TTAGGTGATTCATCTCAAAAAA
SO3286 cydA -203 4.2 TAGTGTGACTAGGGTCTCAGTA
SO2099 hyaA -105 4 ATTCTTGATATGCATCAATAAT
SO0939 SO0939 -382 4.3 TACTGTGATCCCGTTAACCCAA
SO0939 SO0939 -217 4.6 TATCGTGCCTTCGCTCACATTA
SO4452 moaA -220 3.8 TTGGGTGAGCACTGTCACAGAT
SO4606 SO4606 -317 4.2 AGAAGTGATCTTGATCAATTTT
SO0625 sel1 -267 4.2 TTTAGTGATATTAGTCAACTAA
SO1783 feoA -153 4 CATAGAGATTTTTGTCACATAA
SO3699.1 SO3699.1 -183 4 AAGTGTTACACCTATCCCATAT
SO4003 SO4003 -165 3.7 TAAGGTGAGACTGCGCAAAATA
SO1689 SO1689 -96 4.5 AAGTGTGATACTTGCCACAAAA
SO4313 hemC -172 3.9 GATTGTGCTCATGTTAACACTT
SO1414 SO1414 -220 4.3 CTTTGTGAGTTACTTCAAATAC
SO1673 ompW -110 4.4 AATTTTGATTTGGATCAATAAT
SO4504 null -130 4 TTTGATGATCCACTTCAAACTA
SO0397 fdrC -79 3.9 ATTTGTGAGCGATATTAATTTT
SO1666 phhA -75 4.5 AACTGTGAGGGAGTTAACAAAA
SO4700 null -154 4.5 AAAAGTGAGCCAGTTCTCAATT
SO0263 ccmA -222 4.2 TTTTGTGATTAGAATCTCAGCA
SO2757 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
SO0769 argR -266 4.5 ATGTGTGACATGGATCTAATTT
SO1670 fahA -200 5.1 AAATGTGATTTTGTTCACGCTA
SO2010 null -70 4.7 TTTTGTGATCTTCGTCACTGTA
SO0442 purH -180 4.1 TATTGTGAAATCGCGCAGAAAA
SO3421 SO3421 -244 4.2 AAACGAGAGTTAAATCACACTT
SO2753 SO2753 -235 4.7 TTAAGTGATCTGCCTCACTTAA
SO2880 ydhD -157 4.5 ATTTGTGATGTGAATCATTGTT
SO0479 mccA -130 4.3 TAATGTGCTCTAGCGCAGATTT
SO3890 SO3890 -196 4.6 CCATGTGATCTGGTTCAAATTT
SO4591 cymA -307 4 AAATGTCGCCTTGATCACATTT
SO3406 SO3406 -298 3.8 ATTTGTGCACAGCATCAACAAA
SO1410 SO1410 -122 4.5 TGGCGTGATCCAATTCACCTTT
SO1410 SO1410 -82 4.1 TATTGTTAGTCACGTAACAAAA
SO0431 yniC -302 3.9 AAGTATGAATCAGGTCACACTC
SO0431 yniC -118 3.8 TAACGAAATGCTTTTCACAGTA
SO2587 hemB-1 -197 4 GTTTGTGATCGCTATCACTAAC
SO2364 ccoN -173 4.3 TTTTTTGACATGGCTCAAGTAT
SO2881 sodB -91 4.3 AACAATGATTCACATCACAAAT
SO3089 fadI -131 3.9 AAGTTAGAATCAGATCACACTT
SO3896 omp35 -67 4.1 AAATGTGTTAAACCACACAAAA
SO1782 mtrD -339 3.8 TTATGTGACAAAAATCTCTATG
SO4520 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
SO3981 narQ -151 4.5 AATAGTGTTGTTGTTCACACTT
SO3981 narQ -174 3.7 AAGTTTGCGCTAGATCAAAATG
SO1419 SO1419 -117 3.9 AAGTGTTAGCTAACTCATAGAT
SO4019 SO4019 -233 4.2 GATATTGATACAAATCACATTT
SO1389 SO1389 -150 3.8 AACTGTTAGCTTTATCACTCAA
SO1388 SO1388 -232 4.1 TTGAGTGATAAAGCTAACAGTT
SO2535 SO2535 -194 4.4 TTTGTTGATTGCGATCACAATT
SO4667 engB -96 4.7 TAATGTGATCGGGGTAATATTT
SO4666 cytcB -95 4.4 AAATATTACCCCGATCACATTA
SO1778 mtrC -190 3.5 TAGAAAGATCCAAGTCACACAT
SO1778 mtrC -248 3.7 TGTTGTTTTTTTGCTCTCAATT
SO3987 SO3987 -83 3.9 TCTTGTGAGCGAGTTCACGCCT
SO4118 SO4118 -132 4.3 AAATGTGACCTAATTGACGTAT
SO4118 SO4118 -318 4.4 TATTGTAATTTAGTCAACATTT
SO2112 rplY -95 4.4 AAGTGTGATCAAGATCACGTGT
SO3776 SO3776 -137 4.2 CAATGTGAGCGGCTTCAAAATG
SO1278 SO1278 -297 4.4 CATTGTGAGTTGAGTCATATTT
SO1162 lipB -68 5.1 AAGTGTGATCTATCTTACATTT
SO4349 ilvC -86 4 TATAGTGACTTCAATCACAACC
SO1963 hmgA -92 3.8 AATTGATAAGAAGATCACAGTA
SO1787 SO1787 -149 4.2 AACTGAGATCCTGATCACACAG
SO4453 etfD -171 4.3 ATCTGTGACAGTGCTCACCCAA
SO3553 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
SO2581 fadD1 -155 5.1 TTATGTGATGATGATCAAAATT
SO2100 resA -265 4.1 ATTATTGATGCATATCAAGAAT
SO0936 cadC -117 4.6 TTTATTGATGTAATTCACAGAT
SO1965 hmgR -148 4.4 TACTGTGATCTTCTTATCAATT
SO2797 SO2797 -70 4.5 TTATGAGAGCAGAATCACATTT
SO1522 lldP -262 4.6 TTAAGTGACACCGATCACAGTT
SO1522 lldP -180 4.2 CAAAATGATCTAGATCATATAA
SO3855 sfcA -66 4 TTACGTGACCTATAGCACGTCT
SO0162 pckA -150 3.8 CTCAATGATCCAGCTCACACTT
SO4133 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
SO1218 deoA -135 3.9 AAGTGTGACCTAAATCTAGTTG
SO2111 SO2111 -79 4.8 ACACGTGATCTTGATCACACTT
SO3682 null -109 3.8 TTGCGTGATTTTGTGCAAGCAT
SO0849 napD -150 3.9 AACTTTGATCCCGATCGACTAT
SO0849 napD -260 3.9 TAATGTGATTGGTATAAACCTC
SO0935 nhaD -278 4.3 CAATGTGATTGCTATCAACATA
SO4312 cyaA -91 5 AAGTGTGATGGACCTCTCATTT
SO0021 fadB -210 4.1 CTTTGTGCAGTGTATCACAAAG
SO1538 icd -149 4.7 ATTCGTGATATTGCTCACTATT
SO4154 SO4154 -69 3.7 AATTGTGCATTAGTTAATCTAT
SO4154 SO4154 -9 4.9 TAATTTGATATGTATCATATAA
SO1418 apbE -91 3.8 ATCTATGAGTTAGCTAACACTT
SO1329 cyaC -162 4.7 TGTATTGATCCAGATCACAAAT
SO3395 SO3395 -257 4.1 AGATGTGATCGGTTGCGCGAAT
SO3552 SO3552 -152 4.1 TTGTGTGATCATAGTTGCAAAA
SO3914 SO3914 -136 4 AACAGTGATGCTGATTAAATTA
SO1328 SO1328 -109 4 AAAATCGATTTTGCTCACACAA
SO0355 SO0355 -84 4.4 TTATTTGCGCTACATCACAAAA
SO1001 chaA -118 4.6 AAAAGTGATCAAGCTCAAACAT
SO2586 SO2586 -177 4.1 GTTAGTGATAGCGATCACAAAC
Shewanella putrefaciens CN-32
Sputcn32_3506 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Sputcn32_1554 SO2806 -95 4 TCTTGTGAATTGAGTCACAGAG
Sputcn32_1042 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputcn32_1791 fadE2 -72 4.6 AATTGTGATCGCCATCAATAAA
Sputcn32_1272 lldP -179 4 CAAGATGATCTAGATCATATTA
Sputcn32_0354 frdA -255 3.7 TTTTGTGATAACAATTTAAGTT
Sputcn32_0342 null -140 4.1 TTTGATGATCTACTTCAAACTT
Sputcn32_1137 SO1326 -224 4.6 ATTTGTGAGGTAGATCGCTAAA
Sputcn32_1137 SO1326 -293 4.3 AATAGTGATTTTTATTGCAAAT
Sputcn32_2333 cctA -183 4.4 TTACATGATGCAGCGCACATTT
Sputcn32_3220 argR -259 4.2 ATGTGTGACATGGATCTAGTTT
Sputcn32_0540 SO4138 -97 4.2 CATTGTGAAGCGTATCATGTAA
Sputcn32_2359 SO2858 -75 4.2 AGTCGTGATTGTGCTCACACCA
Sputcn32_0539 Sputcn32_0539 -94 4.3 TTACATGATACGCTTCACAATG
Sputcn32_3038 hemG -207 4.5 TTTTGTGAGCAAGCTAAAATTA
Sputcn32_3038 hemG -135 3.9 AATTGATATTTAAATCACCTAG
Sputcn32_3409 acnB -141 4.1 GAGTGTGACCTGATTCATACTT
Sputcn32_3330 SO0544 -242 4 TTTTGTGAATTAGAGTAAAAAT
Sputcn32_3331 SO0543 -88 4.2 ATTTTTACTCTAATTCACAAAA
Sputcn32_0822 SO3811 -116 4.4 TAATGTGATTGGTATAATATAC
Sputcn32_0548 null -90 4.6 TAATTTGACCTAGATCAAAGTT
Sputcn32_1599 Swoo_2741 -183 4.6 AAATGTGATATTGGTCTTAAAT
Sputcn32_0652 crp -174 3.5 TTAGTTGACTAATATCACTAAA
Sputcn32_2725 yfiA-1 -145 4.9 TTCTTTGATGTAACTCACATTT
Sputcn32_1515 SO1821 -140 4.4 TTTTGTGATGTTAATCTACATA
Sputcn32_2490 SO3120 -173 4.3 AAACGCGATCTTTATCACTATT
Sputcn32_3953 SO4743 -116 4.7 TAATTTGATCGGTATCACACTC
Sputcn32_3726 scyA -229 4 CAATTTGATGTGGTTCCAATAA
Sputcn32_3726 scyA -129 3.7 CGCTGAGATTCTAATCACAAAA
Sputcn32_0311 Sbal_0179 -90 4.2 ACTTGGGATTAGTTTCACATTA
Sputcn32_0014 pepQ -302 4.2 CTTTGTGATACACTGCACAGAG
Sputcn32_0078 hutC -178 4.1 TTATGTGAGCTGGCTTGTATTT
Sputcn32_1568 cdd -131 3.8 TATGGTGAAATCGGTCAAATAC
Sputcn32_1568 cdd -82 4.2 AAACGCGAGCTAACTCGCATTT
Sputcn32_3507 SO4519 -224 4.1 TTTTGTTAAGCAGATCATGTTT
Sputcn32_3863 Sbal_2136 -48 4.7 GTTTGTTATCTATATCACATAA
Sputcn32_3219 mdh -46 4 AAACTAGATCCATGTCACACAT
Sputcn32_0388 etfD -171 4.2 ATCTGTGACAGTCCTCACCCAA
Sputcn32_0685 nrfA -149 3.9 AAGTGTGAACAACAACACTATT
Sputcn32_0685 nrfA -126 4.1 CATTTTGATCTGGCGCAAACTT
Sputcn32_3677 SO0318 -246 3.8 AAAAGTGATAATGTTCTTAGAT
Sputcn32_3677 SO0318 -173 3.9 TATCGTGATTAGCTTGACGTAA
Sputcn32_3676 SO0319 -130 4 AAATATGATTTTATTAGCAGTT
Sputcn32_0544 SO4131 -198 4.2 TTATGTGATTTTGACAACAACA
Sputcn32_1483 SO1787 -154 4 AACTGAGATCGGGATCACATGA
Sputcn32_1042 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputcn32_2193 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
Sputcn32_1187 Sbal_3098 -260 4.4 ATTTTTAACCTGCGTCACATTT
Sputcn32_0470 SO4240 -176 4.2 ATTAGTGATCGTTCCCACAGAA
Sputcn32_1392 ompW -211 4.2 ATAAATGCTGCGTATCACATAA
Sputcn32_0692 SO0737 -144 4.4 TAATGTGCGACACAGCACATAA
Sputcn32_0542 SO4134 -89 4.7 AATATTGATCTAAGTCACAATT
Sputcn32_1286 icd -148 4.7 AATCGTGATATCGCTCACTATT
Sputcn32_1480 feoA -155 4.6 CATTGGGATTTTTATCACATAA
Sputcn32_1672 hmgR -148 4.8 TTATGTGATCTTGTTATCAATT
Sputcn32_1792 SO2535 -193 4.7 TTTATTGATGGCGATCACAATT
Sputcn32_1478 mtrC -190 3.5 TAGAAAGATCCAAGTCACACAT
Sputcn32_2377 Spea_1673 -298 3.8 AGTTGTTAAGTGCCTCCCAAAT
Sputcn32_2101 gloA -4 3.8 ATTAATGATCTCGTTAACGCAA
Sputcn32_2101 gloA -120 3.8 TTTTGTGAGCAACAACCAATTT
Sputcn32_1380 mtrF -201 4.5 ATTTGCAATATTCATCACATTT
Sputcn32_0544 SO4131 -157 4.4 AAATGTGAATTTTTGCATATAT
Sputcn32_1334 null -142 4.1 TTCCTTGATTTAGATCACACTC
Sputcn32_3106 cydD -169 4.7 TTTTGTGAATCGGTTAACAAAA
Sputcn32_1272 lldP -261 4.7 CTAAGTGATCGAGATCACAGAT
Sputcn32_2273 sdhC -66 3.8 TGCCGTGATTTATCTCCCAGTT
Sputcn32_0940 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
Sputcn32_3403 SO0439 -90 4.5 AAATGTGAACCAGAGCACACTC
Sputcn32_1043 SO3552 -143 4 CTGTGTGATCATGATTGCAAAT
Sputcn32_1042 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputcn32_3011 SO1064 -57 4.1 AATAGTGATTAATCTCACTTTC
Sputcn32_2347 Sputcn32_2347 -191 4.3 AATTGCAACCTTGCTCACAATT
Sputcn32_3304 SO0572 -102 4.3 TATTTTGACTAAGGTCAAAATT
Sputcn32_1380 mtrF -201 4.5 ATTTGCAATATTCATCACATTT
Sputcn32_1755 hemB-1 -144 4.6 CAATGTGATATAAGTCACTTAA
Sputcn32_3147 napD -147 3.9 AACTTTGATCCCGATCGACTAT
Sputcn32_2193 ycbW -2 3.8 TTATGTTATTAATGCCGCAAAA
Sputcn32_0475 SO4232 -195 4.6 AAAAGTGATTTTTATCACTAAA
Sputcn32_1940 null -274 4 AAATGTTATTTTATTAACAGAG
Sputcn32_1940 null -318 5.7 TAGTGTGATCTACATCACATAA
Sputcn32_3794 yhgI -129 4.2 AATCGTGATCACTTTTGCAAAA
Sputcn32_0543 udp -230 4.4 AAGTTAGATCTGGTTCACACTT
Sputcn32_0543 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Sputcn32_0777 Sputcn32_0777 -140 4.5 AAACTTGATTCGTGTCACACAA
Sputcn32_1484 miaE -105 4.5 TCATGTGATCCCGATCTCAGTT
Sputcn32_1245 Sputcn32_1245 -263 4.5 ATTTGTGACACAGATCGAATTG
Sputcn32_1245 Sputcn32_1245 -234 3.8 ATTTGTAAGTGATTTCCCACTA
Sputcn32_3099 SO3774 -128 3.8 GATAGTGTTGTCCGTCACATTT
Sputcn32_2740 yfiA-2 -77 5.1 TTTTGTGATTTAGATCTCGTTT
Sputcn32_2305 null -65 5.1 TTTTGTGATCTCCATCACCGTT
Sputcn32_1001 purT -119 3.8 TAGCTTGATCAAAAACACAGTT
Sputcn32_1392 ompW -158 4 TTTCGTGATTAGGATCTCAAGT
Sputcn32_2230 icd -212 3.9 AAATGTGATCTGTGCCTAAATG
Sputcn32_0133 SO0141 -174 4.2 TTTCGTGACCTAGATTAGATAT
Sputcn32_1056 rpsT -225 4.5 TTAGGTGATTCATCTCAAAAAA
Sputcn32_2641 cydA -204 4.3 TAGTGTGACGCTTGTCCCAATA
Sputcn32_1051 phk -234 4 TCATGTGATCAAGCCTACATTT
Sputcn32_1051 phk -95 4.1 AATTTGGATGTAGGGCACATTT
Sputcn32_2461 SO3090 -97 4.6 AAGTGTGATCTGATTCTAACTT
Sputcn32_1245 Sputcn32_1245 -234 3.8 ATTTGTAAGTGATTTCCCACTA
Sputcn32_1245 Sputcn32_1245 -263 4.5 ATTTGTGACACAGATCGAATTG
Sputcn32_2489 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Sputcn32_0389 moaA -187 3.8 TTGGGTGAGGACTGTCACAGAT
Sputcn32_3782 SO4606 -309 4.4 ATAAGTGATCTTGATCAATATT
Sputcn32_0653 sel1 -270 4.2 TTTAGTGATATTAGTCAACTAA
Sputcn32_2460 fadI -136 3.9 AAGTTAGAATCAGATCACACTT
Sputcn32_0354 frdA -261 3.9 TTTTGTTTTTGTGATAACAATT
Sputcn32_3440 fdrC -67 4.1 ATTTGTGAGCGATATTAACTTT
Sputcn32_2469 putP -30 3.8 TAATGGGTTCTTGCTCAAACAT
Sputcn32_2469 putP -60 4.2 AGGTTAGATTTTGATCACATTT
Sputcn32_2996 SO3699.1 -183 4 AAGTGTTACGCCTATCCCAAAT
Sputcn32_3387 shew_3181 -216 4.2 TTTTGTGAAGCACTGCAAAGAT
Sputcn32_3139 serA -142 4.2 TTATGCGATATTGTTCTAAATT
Sputcn32_3587 hemC -173 4.1 AAGTGTGCTTATGTTAACACTT
Sputcn32_3587 hemC -133 5.2 AAATGAGATCTGCATCACATTT
Sputcn32_3415 lpdA -111 4.7 TATTGTGATCAGTATCAAACAC
Sputcn32_2088 hyaA -167 3.7 AAATTAGATCTGCGTCATGTTA
Sputcn32_2088 hyaA -107 4 ATTCTTGATATACATCAATAAT
Sputcn32_1959 ccoN -171 4.2 TTTTTTGACATTGCTCAAGTAT
Sputcn32_0086 null -153 4.5 AAAAGTGAACTAGTTCTCAATT
Sputcn32_1671 hmgA -66 4.1 AATTGATAACAAGATCACATAA
Sputcn32_1174 hcp -124 4.3 TAAGGTGATAACCCTCGCAAAT
Sputcn32_0645 astC -142 4.1 AACTGGTATTTTGATCACATTT
Sputcn32_0780 SO3895 -317 4.9 AAATGCGATATAGATCACAAAC
Sputcn32_2739 SO3421 -242 4.8 AAACGAGATCTAAATCACAAAA
Sputcn32_1598 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Sputcn32_1602 SO2753 -234 4.8 TTAAGTGATCTAGCTCACTTAA
Sputcn32_3727 ccmA -213 3.9 TTTTGTGATTAGAATCTCAGCG
Sputcn32_1389 fahA -229 5 AAATGTGATTTGTGTCACGCTA
Sputcn32_3908 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sputcn32_3401 purH -193 4 TATTGTGAAATCACGCAGAAAA
Sputcn32_3663 ygbA -96 4.1 TTTTGTGCGCACCTTCATAAAT
Sputcn32_1807 fumB -103 4.6 AAATGTGATGTAGCCCAAAAAG
Sputcn32_0879 SO0939 -388 4.4 TACTGTGATCTTGCTAACCCAA
Sputcn32_0776 SO3890 -185 4.4 TTGTGTGACACGAATCAAGTTT
Sputcn32_3364 mccA -328 4.3 TAATGTGATCTTATTCGTTATT
Sputcn32_3364 mccA -132 4.3 TAATGTGCTCTAGCTCTGATTT
Sputcn32_1688 ydhD -156 4.5 ATTTGTGATGTGAATCATTGTT
Sputcn32_2727 SO3406 -315 4.5 AATTGTGACTTACCCCTCATTA
Sputcn32_3410 yniC -316 3.9 AAGTATGAATCAGGTCACACTC
Sputcn32_0286 cymA -306 4.7 AAGTGTGCTATCGGTCACAATT
Sputcn32_0956 Spea_3089 -213 4.6 TTATGTGAAGCAGATCGCCATT
Sputcn32_1188 Sputcn32_1188 -111 4.4 AAATGTGACGCAGGTTAAAAAT
Sputcn32_0087 prlC -178 4.3 AATTGAGAACTAGTTCACTTTT
Sputcn32_1386 phhA -75 4.7 AAGTGTGAGGGAGTTAACAAAA
Sputcn32_2193 ycbW -34 4 TTATGTGCGAGTGTTCAAATAG
Sputcn32_3440 fdrC2 -67 4.1 ATTTGTGAGCGATATTAACTTT
Sputcn32_3441 frdC1 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
Sputcn32_1687 sodB -91 4.3 AACAATGATTCACATCACAAAT
Sputcn32_0312 null -99 4.3 AAGTGTGATGCTGGTCAATAAA
Sputcn32_3908 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sputcn32_3276 petA -130 3.7 CACTATGATCTGCTTCTAATTT
Sputcn32_3276 petA -101 3.7 TAATGAGCCCCGCTTCAAACTT
Sputcn32_2823 tsx -268 3.8 AATAGTGATTTCTGTCGTGAAT
Sputcn32_1651 yceI -70 3.8 TAAATGGATGTAAATCACGATT
Sputcn32_3259 SO4019 -235 4.5 AATAGTGATACAAACCACACTT
Sputcn32_3586 cyaA -91 5.4 AAATGTGATGCAGATCTCATTT
Sputcn32_3586 cyaA -51 3.8 AAGTGTTAACATAAGCACACTT
Sputcn32_0343 SO4503 -187 4 AAGTTTGAAGTAGATCATCAAA
Sputcn32_0343 SO4503 -91 4.1 AATTGCGATAGATCACGCATTT
Sputcn32_1287 SO1539 -127 4.5 AATAGTGAGCGATATCACGATT
Sputcn32_3907 engB -96 4.6 TAATGTGATCGGAGTAATATTT
Sputcn32_2087 resA -279 4.2 ATTATTGATGTATATCAAGAAT
Sputcn32_2087 resA -219 3.9 TAACATGACGCAGATCTAATTT
Sputcn32_1140 cyaC -101 4.7 TGTATTGATCCAGATCACAAAT
Sputcn32_0679 SO3987 -83 4 TCTTGTGAGCCAGTTCACGCCT
Sputcn32_0970 fadD-2 -118 4.6 CGTTGTGATGTTTTTCACGATA
Sputcn32_1895 rplY -245 4.4 AAATGTGATCTAGATCTCGTGT
Sputcn32_3102 SO3776 -147 4.2 CAATGTGAGCGGCTTCAAATTG
Sputcn32_2875 lipB -69 5.3 AAATGTGATCTATCTTACATTT
Sputcn32_3615 ilvC -86 4.3 TATAGTGATTTCAATCACAACC
Sputcn32_2982 SO3683 -168 4.3 AGCCGTGATCTTGCTCAAAAAT
Sputcn32_1761 fadD1 -154 5.1 TTATGTGATGATGATCAAAATT
Sputcn32_3571 pckA -151 4 CACCATGATCCAGTTCACACTT
Sputcn32_0784 sfcA -54 4.4 TTACGTGACTTAAAGCACGTAT
Sputcn32_1057 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
Sputcn32_3393 nadC -262 4.5 AAGCGTGATTAGTGTCACAGTT
Sputcn32_3393 nadC -154 4.1 TTTGGTGATTTTTGTCGCGTAA
Sputcn32_3393 nadC -125 3.9 TTTTGCGATTTTTATCGACAAA
Sputcn32_3393 nadC -92 3.8 TGATGTGATAAAGCTACAAAAT
Sputcn32_3393 nadC -57 4.4 ATGTGTGATCTATGCCATAAAT
Sputcn32_1894 SO2111 -66 4.5 ACACGAGATCTAGATCACATTT
Sputcn32_2981 null -76 3.8 ATTTTTGAGCAAGATCACGGCT
Sputcn32_3294 SO0584 -147 4.3 ATTTGTTACTCTGCGCACATTT
Sputcn32_0684 narQ -114 4.5 AATAGTGTTGTTGTTCACACTT
Sputcn32_0013 fadB -210 3.7 CTCTGTGCAGTGTATCACAAAG
Sputcn32_3258 SO4018 -158 4.2 AAGTGTGGTTTGTATCACTATT
Sputcn32_0064 Sbal_4271 -57 4.6 AACCGTGATGCAGATCACTTAT
Sputcn32_2722 SO3395 -259 3.7 AAACGTGATCAGTTACCCGTAA
Sputcn32_3295 bfd -125 4 AAATGTGCGCAGAGTAACAAAT
Sputcn32_0556 mshI -114 3.8 GAATATGACAGGTTTCACGTTT
Sputcn32_1014 SO3588 -312 4.1 AATTTTGAACCAATGCAAATAT
Sputcn32_0554 SO4118 -313 4 TATTGTAATTTAGCCAAAATTT
Sputcn32_3634 SO0355 -84 3.8 CTATTTGCGCAGCATCACAAAA
Sputcn32_3634 SO0355 -45 3.9 TAAAGTGATGGGGTAAAAATAA
Sputcn32_1139 SO1328 -109 3.8 AATGGCGATTCTGCTCACACTC
Sputcn32_1014 SO3588 -44 4.3 TATTTTGATTTTAATCAATTTA
Sputcn32_0539 kefA -94 4.3 TTACATGATACGCTTCACAATG
Sputcn32_2821 deoA -136 3.7 AAGTGTGACCTAAATCTATTTG
Sputcn32_1756 SO2586 -269 4.7 TTAAGTGACTTATATCACATTG
Shewanella sp W3-18-1
Sputw3181_0400 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Sputw3181_1911 gloA -4 3.8 ATTAATGATCTCGTTAACGCAA
Sputw3181_3522 crp -174 3.5 TTAGTTGACTAATATCACTAAA
Sputw3181_1924 hyaA -167 3.7 AAATTAGATCTGCGTCATGTTA
Sputw3181_1924 hyaA -107 4 ATTCTTGATATACATCAATAAT
Sputw3181_1675 cctA -183 4.4 TTACATGATGCAGCGCACATTT
Sputw3181_3027 SO1326 -293 4.3 AATAGTGATTTTTATTGCAAAT
Sputw3181_3027 SO1326 -224 4.3 GTTTGTGATGTAGATCGCTAAA
Sputw3181_0721 argR -259 4.2 ATGTGTGACATGGATCTAGTTT
Sputw3181_3632 SO4138 -97 4.2 CATTGTGAAGCGTATCATGTAA
Sputw3181_1650 SO2858 -75 4.2 AGTCGTGATTGTGCTCACACCA
Sputw3181_3633 Sputcn32_0539 -94 4.3 TTACATGATACGCTTCACAATG
Sputw3181_0907 hemG -207 4.5 TTTTGTGAGCAAGCTAAAATTA
Sputw3181_0907 hemG -135 3.9 AATTGATATTTAAATCACCTAG
Sputw3181_0534 acnB -141 4.1 GAGTGTGACCTGATTCATACTT
Sputw3181_0611 SO0544 -242 4 TTTTGTGAATTAGAGTAAAAAT
Sputw3181_0610 SO0543 -88 4.2 ATTTTTACTCTAATTCACAAAA
Sputw3181_3351 SO3811 -116 4.4 TAATGTGATTGGTATAATATAC
Sputw3181_3624 null -90 4.6 TAATTTGACCTAGATCAAAGTT
Sputw3181_2423 Swoo_2741 -183 4.6 AAATGTGATATTGGTCTTAAAT
Sputw3181_1287 yfiA-1 -145 4.9 TTCTTTGATGTAACTCACATTT
Sputw3181_2585 SO1821 -140 4.4 TTTTGTGATGTTAATCTACATA
Sputw3181_3804 ygbA -96 4.1 TTTTGTGCGCACCTTCATAAAT
Sputw3181_1518 SO3120 -173 4.3 AAACGCGATCTTTATCACTATT
Sputw3181_4050 SO4743 -116 4.7 TAATTTGATCGGTATCACACTC
Sputw3181_0189 scyA -229 4 CAATTTGATGTGGTTCCAATAA
Sputw3181_0189 scyA -129 3.7 CGCTGAGATTCTAATCACAAAA
Sputw3181_3897 Sbal_0179 -90 4.2 ACTTGGGATTAGTTTCACATTA
Sputw3181_3999 hutC -178 4.1 TTATGTGAGCTGGCTTGTATTT
Sputw3181_2531 cdd -131 3.8 TATGGTGAAATCGGTCAAATAC
Sputw3181_2531 cdd -82 4.2 AAACGCGAGCTAACTCGCATTT
Sputw3181_0399 SO4519 -278 4.1 TTTTGTTAAGCAGATCATGTTT
Sputw3181_0090 Sbal_2136 -48 4.5 GTTTGTTATCTATATCACACAA
Sputw3181_0014 pepQ -302 4.2 CTTTGTGATACACTGCACAGAG
Sputw3181_0722 mdh -46 4 AAACTAGATCCATGTCACACAT
Sputw3181_0043 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sputw3181_0242 etfD -171 4.2 ATCTGTGACAGTCCTCACCCAA
Sputw3181_3486 nrfA -149 3.9 AAGTGTGAACAACAACACTATT
Sputw3181_3486 nrfA -126 4.1 CATTTTGATCTGGCGCAAACTT
Sputw3181_2859 Sputcn32_1245 -263 4.5 ATTTGTGACGCAGATCGAATTG
Sputw3181_3818 SO0318 -245 3.8 AAAAGTGATAATGTTCTTAGAT
Sputw3181_3818 SO0318 -173 3.9 TATCGTGATTAGCTTGACGTAA
Sputw3181_3817 SO0319 -130 4 AAATATGATTTTATTAGCAGTT
Sputw3181_0838 cydD -169 4.7 TTTTGTGAATCGGTTAACAAAA
Sputw3181_2618 SO1787 -154 4 AACTGAGATCGGGATCACATGA
Sputw3181_1816 ycbW -34 3.7 TGATGTGCGAGTGTTCAAATAG
Sputw3181_1816 ycbW -2 3.8 TTATGTTATTAATGCCGCAAAA
Sputw3181_1539 putP -60 4.4 ATGTTAGATTTTGATCACATTT
Sputw3181_2977 Sbal_3098 -260 4.4 ATTTTTAACCTGCGTCACATTT
Sputw3181_0373 SO4240 -175 4.2 ATTAGTGATCGCTCCCACAGAA
Sputw3181_1661 Sputcn32_2347 -191 4.3 AATTGCAACCTTGCTCACAATT
Sputw3181_0499 fdrC -67 4.1 ATTTGTGAGCGATATTAACTTT
Sputw3181_2623 mtrC -190 3.5 TAGAAAGATCCAAGTCACACAT
Sputw3181_3630 SO4134 -89 4.7 AATATTGATCTAAGTCACAATT
Sputw3181_2621 feoA -155 4.6 CATTGGGATTTTTATCACATAA
Sputw3181_2721 mtrF -201 4.5 ATTTGCAATATTCATCACATTT
Sputw3181_3629 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Sputw3181_0550 nadC -154 4.1 TTTGGTGATTTTTGTCGCGTAA
Sputw3181_0550 nadC -262 4.8 AAGTGTGATTAGTGTCACAGTT
Sputw3181_2068 null -318 4.6 GCGTGTGATCTATATCACATAA
Sputw3181_1632 Spea_1673 -298 3.8 AGTTGTTAAGTGCCTCCCAAAT
Sputw3181_2234 fadE2 -72 4.6 AATTGTGATCGCCATCAATAAA
Sputw3181_3108 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
Sputw3181_0204 frdA -255 3.7 TTTTGTGATAACAATTTAAGTT
Sputw3181_3774 SO0355 -45 3.9 TAAAGTGATGGGGTAAAAATAA
Sputw3181_3629 udp -230 4.4 AAGTTAGATCTGGTTCACACTT
Sputw3181_3628 SO4131 -157 4.4 AAATGTGAATTTTTGCATATAT
Sputw3181_2834 lldP -179 4 CAAGATGATCTAGATCATATTA
Sputw3181_0804 serA -142 4.2 TTATGCGATATTGTTCTAAATT
Sputw3181_0540 SO0439 -90 4.5 AAATGTGAACCAGAGCACACTC
Sputw3181_3726 hemC -173 4.1 AAGTGTGCTTATGTTAACACTT
Sputw3181_1272 yfiA-2 -77 5.1 TTTTGTGATTTAGATCTCGTTT
Sputw3181_3123 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputw3181_1519 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Sputw3181_1925 resA -219 3.9 TAACATGACGCAGATCTAATTT
Sputw3181_3123 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputw3181_3123 SO3553 -81 4 ATTTGCAATCATGATCACACAG
Sputw3181_0938 SO1064 -57 4.1 AATAGTGATTAATCTCACTTTC
Sputw3181_2769 null -142 4.1 TTCCTTGATTTAGATCACACTC
Sputw3181_1925 resA -279 4.2 ATTATTGATGTATATCAAGAAT
Sputw3181_3774 SO0355 -84 3.8 CTATTTGCGCAGCATCACAAAA
Sputw3181_3866 null -140 4.1 TTTGATGATCTACTTCAAACTT
Sputw3181_1911 gloA -120 3.8 TTTTGTGAGCAACAACCAATTT
Sputw3181_2233 SO2535 -193 4.7 TTTATTGATGGCGATCACAATT
Sputw3181_0637 SO0572 -102 4.3 TATTTTGACTAAGGTCAAAATT
Sputw3181_2721 mtrF -201 4.5 ATTTGCAATATTCATCACATTT
Sputw3181_2270 hemB-1 -144 4.6 CAATGTGATATAAGTCACTTAA
Sputw3181_3616 mshI -114 3.8 GAATATGACAGGTTTCACGTTT
Sputw3181_0796 napD -147 3.9 AACTTTGATCCCGATCGACTAT
Sputw3181_3236 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
Sputw3181_2859 Sputcn32_1245 -234 3.8 ATTTGTAAGTGATTTCCCACTA
Sputw3181_0119 yhgI -129 4.2 AATCGTGATCACTTTTGCAAAA
Sputw3181_3398 Sputcn32_0777 -140 4.5 AAACTTGATTCGTGTCACACAA
Sputw3181_2617 miaE -105 4.5 TCATGTGATCCCGATCTCAGTT
Sputw3181_2859 Sputcn32_1245 -234 3.8 ATTTGTAAGTGATTTCCCACTA
Sputw3181_0845 SO3774 -128 3.8 GATAGTGTTGTCCGTCACATTT
Sputw3181_1703 null -65 5.1 TTTTGTGATCTCCATCACCGTT
Sputw3181_3164 purT -119 3.8 TAGCTTGATCAAAAACACAGTT
Sputw3181_3939 SO0141 -174 4.2 TTTCGTGACCTAGATTAGATAT
Sputw3181_1779 icd -212 3.9 AAATGTGATCTGTGCCTAAATG
Sputw3181_3109 rpsT -225 4.5 TTAGGTGATTCATCTCAAAAAA
Sputw3181_0378 SO4232 -195 4.6 AAAAGTGATTTTTATCACTAAA
Sputw3181_1366 cydA -204 4.3 TAGTGTGACGCTTGTCCCAATA
Sputw3181_3114 phk -95 4.1 AATTTGGATGTAGGGCACATTT
Sputw3181_3114 phk -234 4 TCATGTGATCAAGCCTACATTT
Sputw3181_3294 SO0939 -388 4.4 TACTGTGATCTTGCTAACCCAA
Sputw3181_0243 moaA -187 3.8 TTGGGTGAGGACTGTCACAGAT
Sputw3181_0133 SO4606 -309 4.4 ATAAGTGATCTTGATCAATATT
Sputw3181_3521 sel1 -270 4.2 TTTAGTGATATTAGTCAACTAA
Sputw3181_1548 fadI -136 3.9 AAGTTAGAATCAGATCACACTT
Sputw3181_1539 putP -30 3.8 TAATGGGTTCTTGCTCAAACAT
Sputw3181_0951 SO3699.1 -185 4 AAGTGTTACGCCTATCCCAAAT
Sputw3181_0556 shew_3181 -216 4.2 TTTTGTGAAGCACTGCAAAGAT
Sputw3181_1735 sdhC -66 3.8 TGCCGTGATTTATCTCCCAGTT
Sputw3181_3726 hemC -133 5.2 AAATGAGATCTGCATCACATTT
Sputw3181_2709 ompW -211 4.2 ATAAATGCTGCGTATCACATAA
Sputw3181_2820 icd -148 4.7 AATCGTGATATCGCTCACTATT
Sputw3181_0528 lpdA -111 4.7 TATTGTGATCAGTATCAAACAC
Sputw3181_2046 ccoN -171 4.2 TTTTTTGACATTGCTCAAGTAT
Sputw3181_3979 null -153 4.5 AAAAGTGAACTAGTTCTCAATT
Sputw3181_2990 hcp -124 4.3 TAAGGTGATAACCCTCGCAAAT
Sputw3181_3529 astC -142 4.1 AACTGGTATTTTGATCACATTT
Sputw3181_0188 ccmA -213 3.9 TTTTGTGATTAGAATCTCAGCG
Sputw3181_2424 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Sputw3181_2420 SO2753 -234 4.8 TTAAGTGATCTAGCTCACTTAA
Sputw3181_2545 SO2806 -95 4 TCTTGTGAATTGAGTCACAGAG
Sputw3181_2712 fahA -229 5 AAATGTGATTTGTGTCACGCTA
Sputw3181_0542 purH -193 4 TATTGTGAAATCACGCAGAAAA
Sputw3181_1273 SO3421 -242 4.8 AAACGAGATCTAAATCACAAAA
Sputw3181_2218 fumB -103 4.6 AAATGTGATGTAGCCCAAAAAG
Sputw3181_3294 SO0939 -253 3.5 AAATGGATTTAAATTCACATAA
Sputw3181_3399 SO3890 -185 4.4 TTGTGTGACACGAATCAAGTTT
Sputw3181_0577 mccA -132 4.3 TAATGTGCTCTAGCTCTGATTT
Sputw3181_0577 mccA -328 4.3 TAATGTGATCTTATTCGTTATT
Sputw3181_2337 ydhD -156 4.5 ATTTGTGATGTGAATCATTGTT
Sputw3181_1285 SO3406 -315 4.5 AATTGTGACTTACCCCTCATTA
Sputw3181_0533 yniC -316 3.9 AAGTATGAATCAGGTCACACTC
Sputw3181_3916 cymA -306 4.1 AAGTGTGCCATCGATTACAATT
Sputw3181_3220 Spea_3089 -213 4.6 TTATGTGAAGCAGATCGCCATT
Sputw3181_2976 Sputcn32_1188 -111 4.4 AAATGTGACGCAGGTTAAAAAT
Sputw3181_3708 pckA -151 4 CACCATGATCCAGTTCACACTT
Sputw3181_0499 fdrC2 -67 4.1 ATTTGTGAGCGATATTAACTTT
Sputw3181_0498 frdC1 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
Sputw3181_3628 SO4131 -198 4.2 TTATGTGATTTTGACAACAACA
Sputw3181_2338 sodB -91 4.3 AACAATGATTCACATCACAAAT
Sputw3181_3896 null -99 4.2 AAGTGTGATACTGGTCAATAAA
Sputw3181_0043 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sputw3181_1188 tsx -268 3.8 AATAGTGATTTCTGTCGTGAAT
Sputw3181_0665 petA -130 3.7 CACTATGATCTGCTTCTAATTT
Sputw3181_0665 petA -101 3.7 TAATGAGCCCCGCTTCAAACTT
Sputw3181_2375 yceI -70 3.8 TAAATGGATGTAAATCACGATT
Sputw3181_0682 SO4019 -236 4.5 AATAGTGATACAAACCACACTT
Sputw3181_3725 cyaA -91 5.4 AAATGTGATGCAGATCTCATTT
Sputw3181_3725 cyaA -51 3.8 AAGTGTTAACATAAGCACACTT
Sputw3181_3865 SO4503 -131 4 AAGTTTGAAGTAGATCATCAAA
Sputw3181_3865 SO4503 -35 4.1 AATTGCGATAGATCACGCATTT
Sputw3181_2819 SO1539 -127 4.5 AATAGTGAGCGATATCACGATT
Sputw3181_0044 engB -96 4.6 TAATGTGATCGGAGTAATATTT
Sputw3181_3024 cyaC -101 4.7 TGTATTGATCCAGATCACAAAT
Sputw3181_3492 SO3987 -83 4 TCTTGTGAGCCAGTTCACGCCT
Sputw3181_3197 fadD-2 -117 4.6 CGTTGTGATGTTTTTCACGATA
Sputw3181_2113 rplY -245 4.4 AAATGTGATCTAGATCTCGTGT
Sputw3181_0842 SO3776 -147 4.2 CAATGTGAGCGGCTTCAAATTG
Sputw3181_1028 lipB -75 5.3 AAATGTGATCTATCTTACATTT
Sputw3181_2354 hmgA -66 4.1 AATTGATAACAAGATCACATAA
Sputw3181_3755 ilvC -86 4.3 TATAGTGATTTCAATCACAACC
Sputw3181_3395 SO3895 -317 4.9 AAATGCGATATAGATCACAAAC
Sputw3181_3478 SO0737 -144 4.4 TAATGTGCGACACAGCACATAA
Sputw3181_0965 SO3683 -168 4.3 AGCCGTGATCTTGCTCAAAAAT
Sputw3181_2353 hmgR -148 4.8 TTATGTGATCTTGTTATCAATT
Sputw3181_2715 phhA -75 4.7 AAGTGTGAGGGAGTTAACAAAA
Sputw3181_2264 fadD1 -154 5.1 TTATGTGATGATGATCAAAATT
Sputw3181_0204 frdA -261 3.9 TTTTGTTTTTGTGATAACAATT
Sputw3181_2834 lldP -261 4.7 CTAAGTGATCGAGATCACAGAT
Sputw3181_3391 sfcA -54 4.4 TTACGTGACTTAAAGCACGTAT
Sputw3181_0550 nadC -125 3.9 TTTTGCGATTTTTATCGACAAA
Sputw3181_0550 nadC -92 3.8 TGATGTGATAAAGCTACAAAAT
Sputw3181_0550 nadC -57 3.8 GTGTGTGATCTATGCCATAAAT
Sputw3181_2114 SO2111 -66 4.5 ACACGAGATCTAGATCACATTT
Sputw3181_0966 null -76 3.8 ATTTTTGAGCAAGATCACGGCT
Sputw3181_0647 SO0584 -147 4.3 ATTTGTTACTCTGCGCACATTT
Sputw3181_3487 narQ -114 4.5 AATAGTGTTGTTGTTCACACTT
Sputw3181_3978 prlC -178 4.3 AATTGAGAACTAGTTCACTTTT
Sputw3181_2859 Sputcn32_1245 -263 4.5 ATTTGTGACGCAGATCGAATTG
Sputw3181_1816 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
Sputw3181_0013 fadB -210 3.7 CTCTGTGCAGTGTATCACAAAG
Sputw3181_0683 SO4018 -159 4.2 AAGTGTGGTTTGTATCACTATT
Sputw3181_1547 SO3090 -97 4.6 AAGTGTGATCTGATTCTAACTT
Sputw3181_1290 SO3395 -259 3.7 AAACGTGATCAGTTACCCGTAA
Sputw3181_0646 bfd -125 4 AAATGTGCGCAGAGTAACAAAT
Sputw3181_3151 SO3588 -44 4.3 TATTTTGATTTTAATCAATTTA
Sputw3181_1190 deoA -136 3.7 AAGTGTGACCTAAATCTATTTG
Sputw3181_3151 SO3588 -312 4.1 AATTTTGAACCAATGCAAATAT
Sputw3181_3025 SO1328 -109 3.9 AATGGCGATTCGGCTCACACTC
Sputw3181_3618 SO4118 -313 4 TATTGTAATTTAGCCAAAATTT
Sputw3181_3633 kefA -94 4.3 TTACATGATACGCTTCACAATG
Sputw3181_2269 SO2586 -269 4.7 TTAAGTGACTTATATCACATTG
Sputw3181_3122 SO3552 -143 4 CTGTGTGATCATGATTGCAAAT
Shewanella sp ANA-3
Shewana3_1042 deoA -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewana3_2536 SO2753 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewana3_0024 fadB -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewana3_3348 nhaD -239 4.3 CAATGTGATTGATATCAATAAA
Shewana3_0386 hemC -172 4.2 AAGTGTGCTCATGTTAACACTT
Shewana3_3757 SO4232 -201 4.6 AAAAGTGATTTATCTCACTAAA
Shewana3_3963 null -99 5.2 AAATGTGATCTATGTCAAAAAA
Shewana3_3619 psrA -278 3.8 TCTATTGATCCTATTCACGAAT
Shewana3_3048 SO1326 -294 4.3 AATAGTGATTTTTATTGCAAAT
Shewana3_2511 cctA -183 4.4 TTACATGATGCAGCGCACATTT
Shewana3_0610 astC -142 4 AACTGGTATTTTGATCACAATT
Shewana3_2588 SO2806 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewana3_3684 Sputcn32_0539 -94 4.3 TTACATGATACGCTTCACAATG
Shewana3_0871 hemG -317 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewana3_0433 acnB -66 4.1 GAGTGTGACCTGATTCATACTT
Shewana3_0542 SO0544 -144 4.3 TTTTGTGATTTAGCGCATAACT
Shewana3_0541 SO0543 -193 4.1 AGTTATGCGCTAAATCACAAAA
Shewana3_3675 null -93 4.3 TTAATTGACCTAGATCAAACTT
Shewana3_2541 Swoo_2741 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewana3_3683 SO4138 -96 4.2 CATTGTGAAGCGTATCATGTAA
Shewana3_2628 SO1821 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewana3_3845 ygbA -97 4.1 TTTTGTGCGCATCTTCATAAAT
Shewana3_1428 SO3120 -187 4.3 AAACGCGATCTTTATCACTATT
Shewana3_1151 yfiA-1 -142 4.6 TTCTTTGATAAGTCTCACATTT
Shewana3_0232 scyA -234 4 CAATTTGATGTGGTTCCAATAA
Shewana3_0232 scyA -125 4.1 TGCTGAGATTCTAATCACAAAA
Shewana3_3906 ppc -233 3.7 AATATTGCGTTAGCTCGCATTT
Shewana3_3906 ppc -189 3.7 TATCGCGATTAGTTGCATATAA
Shewana3_0099 hutC -142 4.1 TTATGTGAGCTAGCTTGTATTT
Shewana3_4051 prlC -136 4.6 AATTGTGAACTGGTTCGCTTTT
Shewana3_2573 cdd -82 4.1 AAACGCGAACTAACTCGCATTT
Shewana3_3925 SO4519 -236 4.1 TTTTGTTAAGCAGATCATGTTT
Shewana3_0952 Sbal_2136 -117 3.7 TTATTTGATACGACTTAAGAAT
Shewana3_0952 Sbal_2136 -90 5.1 ATTTGTTATATTTATCACATAA
Shewana3_3964 Sbal_0179 -287 3.8 AGTTAAGATACAGAGCACATTA
Shewana3_3964 Sbal_0179 -92 4.1 ACTTGAGACTGGTTTCACATTA
Shewana3_0025 pepQ -255 4.4 CTTTGTGATACACTGCACAAAG
Shewana3_3509 mdh -46 4.3 AAATTAGATCCATGTCACACAT
Shewana3_4111 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewana3_0786 SO3811 -142 4.1 AATTGTTAAGTATTTCATATTG
Shewana3_2985 SO1389 -150 4.2 AAATGTTATCTTTATCACTCAG
Shewana3_2830 null -136 4.1 TTCCTTGATTTAGATCACACTC
Shewana3_0658 nrfA -131 3.9 AAGTGTGAACAACAACACTATT
Shewana3_0658 nrfA -108 4.1 CATTTTGATCTAGCGCAAACTT
Shewana3_2937 Sputcn32_1245 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewana3_3138 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewana3_1429 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewana3_3679 SO4131 -157 3.8 AATTGTAAATTTTTGCATATAT
Shewana3_3679 SO4131 -199 4.1 TTATGTGATTTTCACAACAACA
Shewana3_3088 SO1278 -217 4.1 TTTCGCGATAAATATCAAACTT
Shewana3_0428 lpdA -113 4.7 TATTGTGATCAGTATCAAACAC
Shewana3_0401 frdC1 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
Shewana3_2937 Sputcn32_1245 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewana3_2556 null -125 4.1 AATTGTGCCGGATATCACTTTC
Shewana3_2671 feoA -276 5 AAGTGTGATCTTGTTCTCACTT
Shewana3_2521 Sputcn32_2347 -223 4.2 TTGAGTGAAAGTCGTCACATAA
Shewana3_3681 SO4134 -91 4.6 AATATTGATCCATATCACGTTT
Shewana3_0799 Sputcn32_0834 -156 4.2 AAAGGTGACGAGTATAACAAAA
Shewana3_3145 phk -95 4 AATTTGGATGCAGGGCACATTT
Shewana3_0812 cydD -167 4.5 TTTTGTGAATAGGCTAACAAAA
Shewana3_2302 fumB -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewana3_0738 Sputcn32_0777 -140 4.4 AAATTTGAACCACATCACACAG
Shewana3_0451 nadC -262 4.4 AAGTTTGACATGGGTCACAGTT
Shewana3_2481 hmgA -144 3.9 TTTTTAGATTGAGATAACAGAT
Shewana3_3154 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewana3_2671 feoA -153 4.4 CATTGAGATTTTTGTCACATAA
Shewana3_1142 null -85 4.4 GGATGTGAGTTGCTTCACAATT
Shewana3_0938 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewana3_0438 SO0439 -78 4.2 AAGCGTGAGCTAACGCACACAA
Shewana3_2323 fadE2 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewana3_1142 swp_3747 -85 4.4 GGATGTGAGTTGCTTCACAATT
Shewana3_0133 SO0141 -163 4.1 TTTCGTGAGCTAGATTAGATAT
Shewana3_3669 SO4118 -312 4.2 TATTGTAATTTAATCAACATTT
Shewana3_3667 mshI -119 4.2 GGATATGATGGGTTTCACATTT
Shewana3_3154 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewana3_3416 serA -143 3.9 TTATGCGATATTGTTCTAATTC
Shewana3_3045 cyaC -162 4.4 TGGATTGATCCAGATCACAAAT
Shewana3_0861 swp_4060 -204 4 AAACTTGCATCAGCTCACATAA
Shewana3_0601 petA -103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewana3_0903 fkpA -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewana3_0739 SO3890 -181 4.9 CTGTGTGATGTGGTTCAAATTT
Shewana3_1451 putP -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewana3_0572 SO0572 -102 4.4 TATTTTGACTCATGTCAAAAAT
Shewana3_0666 SO3967 -125 4.2 TTAAGTGATCTTGGCCACAATC
Shewana3_2910 Shewana3_2910 -280 4.3 TTATTAGATGGTCATCACACTT
Shewana3_3197 purT -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewana3_2676 mtrC -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewana3_2986 SO1388 -233 4.2 CTGAGTGATAAAGATAACATTT
Shewana3_0617 crp -174 3.5 TTAGTTGACTAATATCACTAAA
Shewana3_0387 cyaA -52 3.9 AAGTGTTAACATGAGCACACTT
Shewana3_0800 SO3797 -53 4.5 TTTTGTTATACTCGTCACCTTT
Shewana3_1787 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
Shewana3_1787 ycbW -34 3.7 TGATGTGCGAGTGTTCAAATAG
Shewana3_1787 ycbW -2 4 TTATGTTATTATTGCCACAAAA
Shewana3_3585 SO4018 -159 5.1 AAATGTGATTTGTATCAACTTT
Shewana3_1459 SO3090 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewana3_4003 yhgI -128 4.1 AAGCGTGATGGATTTTGCAAAA
Shewana3_2787 mtrF -201 3.9 ATCTGCGAGATACCTCATATAT
Shewana3_2889 SO1539 -127 4.5 AATAGTGAGCAATATCACGATT
Shewana3_2667 miaE -150 4.5 CTATGTGATCAGGATCTCAGTT
Shewana3_0819 SO3774 -131 4.4 TATAGTGTTGTCCGTCACATTT
Shewana3_0733 omp35 -67 4.1 AAATGTGTTAAACCACACAAAA
Shewana3_1628 yceI -102 4.6 TTAGGTGATCTTTGTCACAGAT
Shewana3_0601 petA -132 3.7 CACTATGATCTGCTTCTAATTT
Shewana3_1750 icd -209 3.9 AAATGTGATCTACGCCTAAATG
Shewana3_1241 cydA -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewana3_3154 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewana3_2232 gloA -153 4.4 CAAAGTGACGTAGCTCACAAAG
Shewana3_2232 gloA -205 4 TTTTGTGAGCAAGAGCTAAATA
Shewana3_3344 SO0939 -217 3.8 TAATGTGCGCTGCCGCAAATTG
Shewana3_3344 SO0939 -384 4.3 TACTGTGATCCCGTTAACCCAA
Shewana3_0274 moaA -187 3.8 TTGGGTGAGCACTGTCACAGAT
Shewana3_3991 SO4606 -318 4.2 AGAAGTGATCTTGATCAATTTT
Shewana3_0618 sel1 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewana3_1460 fadI -135 3.9 AAGTTAGAATCAGATCACACTT
Shewana3_1134 SO3421 -241 4.9 AAACGAGATCTAAATCACATTT
Shewana3_3266 SO3699.1 -176 4.3 AAATGTTACGCCTATCCCATAT
Shewana3_3365 SO0919 -307 3.9 TTAATTGAAGCTGGTCGCATTT
Shewana3_0479 SO4003 -159 4.1 TTTTATGATGATTTTCATATTG
Shewana3_2761 SO1689 -96 4.5 AAGTGTGATACTTGCCACAAAA
Shewana3_0386 hemC -132 4.3 AAATGAGAAGTTCGTCACACTT
Shewana3_3688 SO4142 -118 4.2 GAAAGTGATACACCTCAAATAA
Shewana3_3911 null -225 3.8 ATGCGTGATCCGTCGCAATTAT
Shewana3_3911 null -131 3.9 TTTGATGATCCACCTCAAACAA
Shewana3_1040 tsx -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewana3_0402 fdrC -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewana3_2781 phhA -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewana3_2107 ccoN -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewana3_0734 Shewana3_0734 -130 4.8 TCAAGTGATCAAGATCACATTT
Shewana3_4052 null -154 4.3 AAAAGCGAACCAGTTCACAATT
Shewana3_0231 ccmA -222 4.2 TTTTGTGATTAGAATCTCAGCA
Shewana3_2542 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Shewana3_2778 fahA -197 5.1 AAATGTGATTTTGCTCACGCTA
Shewana3_1574 SO2858 -105 4 GGATGTGAGCCGCTTCGCAAAT
Shewana3_0441 purH -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewana3_3910 SO4503 -187 4 TTGTTTGAGGTGGATCATCAAA
Shewana3_3910 SO4503 -91 4 AATTGCGACGGATCACGCATTT
Shewana3_1958 null -276 4.4 AAATGTTATTTTCTTAACAGTT
Shewana3_1640 ydhD -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewana3_3977 cymA -309 4 AAATGTCGCGTGGATCACATTT
Shewana3_1149 SO3406 -278 4.8 ATTTGTGACAAATTGCACATTA
Shewana3_1149 SO3406 -205 4.1 ATTCGTTAGGGATCTCACAGAT
Shewana3_0489 mccA -328 3.8 GAATGTGATCTGTCTCGGCATT
Shewana3_0862 cobA -248 4.2 TTATGTGAGCTGATGCAAGTTT
Shewana3_0432 yniC -315 3.9 AAGTATGAATCAGGTCACACTC
Shewana3_2392 hemB-1 -222 4 GTTTGTGATCGCCATCACTAAC
Shewana3_0735 SO3895 -308 4.5 AAATGTGATCTTGATCACTTGA
Shewana3_1639 sodB -91 4.3 AACAATGATTCACATCACAAAT
Shewana3_2672 mtrD -295 4.4 TTATGTGACAAAAATCTCAATG
Shewana3_2672 mtrD -172 4.3 AAGTGAGAACAAGATCACACTT
Shewana3_3926 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Shewana3_0657 narQ -115 4.5 AATAGTGTTGTTGTTCACACTT
Shewana3_0657 narQ -138 3.7 AAGTTTGCGCTAGATCAAAATG
Shewana3_3429 napD -149 3.9 AACTTTGATCCCGATCGACTAT
Shewana3_1133 yfiA-2 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewana3_4111 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewana3_1958 null -320 5.2 AAGTGTGACACACATCACATAT
Shewana3_2322 SO2535 -133 4.4 TTTGTTGATTGCGATCACAATT
Shewana3_4110 engB -96 4.7 TAATGTGATCGGGGTAATATTT
Shewana3_1880 hyaA -166 3.9 AAATTAGATCTGCATCATGTTA
Shewana3_1880 hyaA -106 4.2 ATTCTTGATATGCATCAAGAAT
Shewana3_0651 SO3987 -83 4 TCTTGTGAGCCAGTTCACGCCT
Shewana3_1892 rplY -234 3.8 TTTTTTGATTCAGATCAAAGCC
Shewana3_0817 SO3776 -141 4.2 CAATGTGAGCGGCTTCAAATTG
Shewana3_0402 fdrC2 -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewana3_2787 mtrF -201 3.9 ATCTGCGAGATACCTCATATAT
Shewana3_0989 lipB -74 5.2 AAATGTGATCTGTCTTACATTT
Shewana3_2481 hmgA -88 3.9 AATTGATAAGAAGATCACACTA
Shewana3_0355 ilvC -86 4.3 TATAGTGATTTCAATCACAACC
Shewana3_2668 SO1787 -151 4.4 AACTGAGATCCTGATCACATAG
Shewana3_0273 etfD -175 4.3 ATCTGTGACAGTGCTCACCCAA
Shewana3_2386 fadD1 -155 5.1 TTATGTGATGATGATCAAAATT
Shewana3_2480 hmgR -92 3.9 ATCTGTTATCTCAATCTAAAAA
Shewana3_3347 cadC -118 4.6 TTTATTGATGTGTTTCACAGAT
Shewana3_1881 resA -251 4.2 ATTCTTGATGCATATCAAGAAT
Shewana3_1881 resA -191 4.2 TAACATGATGCAGATCTAATTT
Shewana3_2480 hmgR -148 4.6 TAGTGTGATCTTCTTATCAATT
Shewana3_0147 pckA -151 3.8 CTCAATGATCCAGCTCACACTT
Shewana3_3684 kefA -94 4.3 TTACATGATACGCTTCACAATG
Shewana3_0812 cydD -187 4.4 TTTATTGATCTTTATCTCATTT
Shewana3_2579 SO2797 -102 4.7 TTATGCGAGCGGAATCACATTT
Shewana3_2904 lldP -263 4.1 TCGAGTGACATGGATCACAGTT
Shewana3_2904 lldP -181 4.2 CAAAATGATCTAGATCATATTA
Shewana3_0750 sfcA -65 3.9 TTACGTGACTTACAGCACGTCT
Shewana3_3680 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Shewana3_1891 SO2111 -79 3.9 ACCCGCGATCTTGATCACACTT
Shewana3_3866 SO0319 -84 4.6 TTTTGTGAAACGTTTCACTATT
Shewana3_3864 SO0321 -25 3.8 TAGCGTGTTTTTCATCGAATTT
Shewana3_0582 SO0584 -157 4.4 TTTTGTTACTCATCGCACATTT
Shewana3_0902 SO1064 -56 4.3 AACTGTGATTAATCTCACTCTA
Shewana3_0387 cyaA -92 4.7 AAGTGTGACGAACTTCTCATTT
Shewana3_4030 Sputcn32_3857 -316 4.9 TTTTCTGATTCAGCTCACATTA
Shewana3_2775 ompW -107 3.8 AATCTTGATTTGGATCAATAAG
Shewana3_2890 icd -149 4.7 AATCGTGATATTGCTCACTATT
Shewana3_3510 argR -266 4.5 ATGTGTGACATGGATCTAATTT
Shewana3_3924 Shewana3_3924 -304 4.7 TTTTGCGATCTGCCTCACAATC
Shewana3_0083 Sbal_4271 -54 4.9 AAACGTGATGCGGATCACTTAT
Shewana3_3695 SO4154 -9 4.3 TAATTTGATATGTACCATATAA
Shewana3_1157 SO3395 -261 4.2 AGTTGTGATCTTTGGCGCGTAT
Shewana3_0581 bfd -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewana3_3180 SO3588 -117 4.2 TATTTTGATTGTGATCTCTTTA
Shewana3_3153 SO3552 -165 4.1 TTGTGTGATCATAGTTGCAAAA
Shewana3_3088 SO1278 -60 4.1 AAAAATGAACTAGATCAAAATA
Shewana3_0095 Shewana3_0095 -80 4.8 AAATTTGAGCTTGATCACACTA
Shewana3_0716 SO3914 -135 4.2 AATTGTGACTAAGATTAAATTG
Shewana3_3046 SO1328 -109 3.9 AAAATCGATTTTGCTCACAGTA
Shewana3_3290 chaA -118 4.3 AAAAGCGATCTCGCTCAAAAAT
Shewana3_2391 SO2586 -176 4.2 GTTAGTGATGGCGATCACAAAC
Shewanella sp MR-4
Shewmr4_3127 cydD -187 4.4 TTTATTGATCTTTATCTCATTT
Shewmr4_3127 cydD -167 4.5 TTTTGTGAATAGGCTAACAAAA
Shewmr4_2973 SO3552 -165 4.4 TTGTGTGATCATAGTTACAAAA
Shewmr4_3444 psrA -273 4 CTTATTGATCTTATTCACGATT
Shewmr4_2318 cctA -184 4.4 TTACATGATGCAGCGCACATTT
Shewmr4_2871 Shewmr4_2871 -55 4.3 AATAGTGATTTTTATTGCAAAT
Shewmr4_3340 argR -266 4.5 ATGTGTGACATGGATCTAATTT
Shewmr4_3842 prlC -136 4.3 AATTGTGAACTGAGTCGCTTTT
Shewmr4_3509 Sputcn32_0539 -94 4.3 TTACATGATACGCTTCACAATG
Shewmr4_3066 hemG -320 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewmr4_0437 acnB -66 4.1 GAGTGTGACCTGATTCATACTT
Shewmr4_0543 SO0544 -146 4.1 TTTTGTGATTAAGCGCATAACT
Shewmr4_0542 SO0543 -192 4 AGTTATGCGCTTAATCACAAAA
Shewmr4_3498 null -187 4.2 AACATTGAACTAGATCACAATT
Shewmr4_3498 null -93 4.3 TTAATTGACCTAGATCAAACTT
Shewmr4_3508 SO4138 -96 4.2 CATTGTGAAGCGTATCATGTAA
Shewmr4_2376 Swoo_2741 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewmr4_1150 yfiA-1 -142 4.6 TTCTTTGATAAATCTCACATTT
Shewmr4_2468 SO1821 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewmr4_3649 ygbA -97 4.1 TTTTGTGCGCATCTTCATAAAT
Shewmr4_1375 SO3120 -186 4.3 AAACGCGATCTTTATCACTATT
Shewmr4_3922 SO4743 -116 4.3 AAACTTGATCTAAGTCACGCTA
Shewmr4_0232 scyA -234 4 CAATTTGATGTGGTTCCAATAA
Shewmr4_0232 scyA -125 4.1 TGCTGAGATTCTAATCACAAAA
Shewmr4_1573 ydhD -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewmr4_3710 ppc -228 3.7 AATATTGCGTTAGCTCGCATTT
Shewmr4_3710 ppc -184 4.3 TATCGTGATTAGTTGCATATAA
Shewmr4_3766 Sbal_0179 -92 4.1 ACTTGAGACTGGTTTCACATTA
Shewmr4_0098 hutC -142 4.1 TTATGTGAGCCAGCTTGTATTT
Shewmr4_2832 hcp -124 4 TAAGGTGATCTCCCTCTAAGAT
Shewmr4_2411 cdd -82 4.1 AAACGCGAACTAACTCGCATTT
Shewmr4_3729 SO4519 -236 4.1 TTTTGTTAAGCAGATCATGTTT
Shewmr4_0950 Sbal_2136 -84 4.9 ATTTGTTACATTTATCACATAA
Shewmr4_3766 Sbal_0179 -287 3.7 AGTTAAGATACAGAACACATTA
Shewmr4_0019 pepQ -255 4.4 CTTTGTGATACACTGCACAAAG
Shewmr4_3339 mdh -46 4.3 AAATTAGATCCATGTCACACAT
Shewmr4_1513 SO2858 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewmr4_3907 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewmr4_3152 SO3811 -142 4.1 AATTGTTAAGTATTTCATATTG
Shewmr4_2656 null -136 4.1 TTCCTTGATTTAGATCACACTC
Shewmr4_0659 nrfA -131 3.9 AAGTGTGAACAACAACACTATT
Shewmr4_0659 nrfA -108 4.1 CATTTTGATCTAGCGCAAACTT
Shewmr4_2761 Sputcn32_1245 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewmr4_3652 SO0321 -25 3.8 TAGCGTGTTTTTCATCGAATTT
Shewmr4_3223 SO3890 -198 4.3 CCCTGTGATCTAGCTCAAATTT
Shewmr4_2373 SO2753 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewmr4_0272 etfD -175 4.3 AACTGTGACAGCGCTCACCCAA
Shewmr4_2107 gloA -153 4.8 CAAAGTGATACAGCTCACATTA
Shewmr4_2959 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewmr4_3584 SO4232 -201 4.6 AAAAGTGATTTATCTCACTAAA
Shewmr4_1376 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewmr4_3504 SO4131 -157 3.8 AATTGTAAATTTTTGCATATAT
Shewmr4_0430 lpdA -113 4.7 TATTGTGATCAGTATCAAACAC
Shewmr4_0783 cadC -246 3.8 CAATGTGCATCAACGCACATTA
Shewmr4_2393 null -125 4.1 AATTGTGCCGGATATCACTTTC
Shewmr4_1903 null -275 3.9 AAATGTTATTTTATTAACAGCT
Shewmr4_3822 Sputcn32_3857 -316 4.6 TTTTCTGACGCCGCTCACATTA
Shewmr4_0134 SO0141 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Shewmr4_2510 mtrC -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewmr4_3506 SO4134 -205 4 AAGTGTGAGCCAGATCTAACTC
Shewmr4_3506 SO4134 -91 4.6 AATATTGATCCAAATCACGTTT
Shewmr4_3139 Sputcn32_0834 -156 4.2 AAAGGTGACGAGTATAACAAAA
Shewmr4_2965 phk -95 4.3 AATTTGGATGTAGAACACATTT
Shewmr4_2290 hmgR -148 4.6 TAGTGTGATCTTCTTATCAATT
Shewmr4_2290 hmgR -92 3.9 ATCTGTTATCTCAATCTAAAAA
Shewmr4_3504 SO4131 -199 4.1 TTATGTGATTTTCACAACAACA
Shewmr4_3226 SO3895 -309 3.9 AAATGTGATCTGGATCATTGGA
Shewmr4_2146 fadE2 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewmr4_2974 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr4_1823 resA -206 4.2 TAACATGATGCAGATCTAATTT
Shewmr4_1133 SO3421 -241 4.9 AAACGAGATCTAAATCACATTT
Shewmr4_1561 yceI -103 4.8 TTAGGTGATCTTTGTCACAAAT
Shewmr4_0936 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewmr4_0388 hemC -132 4.3 AAATGAGAAGTTCGTCACACTT
Shewmr4_0388 hemC -172 4.2 AAGTGTGCTCATGTTAACACTT
Shewmr4_0442 SO0439 -77 3.8 AAGCGTGAACTTAAGCACACTC
Shewmr4_2613 mtrF -202 4 ATTTGTTACCCACCTCTTATTT
Shewmr4_1141 swp_3747 -85 5 AGATGTGACTTGCCTCACAATT
Shewmr4_1572 sodB -91 4.3 AACAATGATTCACATCACAAAT
Shewmr4_0718 serA -143 3.9 TTATGCGATATTGTTCTAATTC
Shewmr4_2974 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr4_2107 gloA -205 4 TTTTGTGAGCAAGAGCTAAATA
Shewmr4_0705 napD -149 3.9 AACTTTGATCCCGATCGACTAT
Shewmr4_2145 SO2535 -193 4.4 TTTGTTGATTGCGATCACAATT
Shewmr4_1406 SO3090 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewmr4_1903 null -319 5.6 AAATGTGATGTGCGTCACATTT
Shewmr4_3492 SO4118 -312 4.2 TATTGTAATTTAATCAACATTT
Shewmr4_0573 SO0572 -102 4.5 TATTTTGACGCATGTCAAAATT
Shewmr4_2741 Shewana3_2910 -271 4.5 TAATGTTAGCCCCCTCACACTT
Shewmr4_0667 SO3967 -125 4.2 TTAAGTGATCTTGGCCACAATC
Shewmr4_3228 omp35 -67 3.7 AAATGTGTAAAACCACACAAAA
Shewmr4_2720 icd -149 4.7 AATCGTGATATTGCTCACTATT
Shewmr4_3511 SO4142 -118 4.2 GAAAGTGATACACCTCAAATAA
Shewmr4_0602 petA -103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewmr4_0602 petA -132 3.7 CACTATGATCTGCTTCTAATTT
Shewmr4_2505 feoA -153 4.4 CATTGAGATTTTTGTCACATAA
Shewmr4_1682 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
Shewmr4_1682 ycbW -34 3.8 TGATGTGCCAGTGTTCAAATAG
Shewmr4_1682 ycbW -2 4 TTATGTTATTATTGCCACAAAA
Shewmr4_2867 cyaC -162 4.4 TGGATTGATCCAGATCACAAAT
Shewmr4_3804 yhgI -128 4.1 AAGCGTGATGGATTTTGCAAAA
Shewmr4_3505 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Shewmr4_2501 miaE -151 4.1 CGGTGTGATCAGGATCTCAGTT
Shewmr4_3138 SO3797 -53 4.5 TTTTGTTATACTCGTCACCTTT
Shewmr4_3122 SO3774 -132 4.4 TATAGTGTTGTCCGTCACATTT
Shewmr4_2613 mtrF -202 4 ATTTGTTACCCACCTCTTATTT
Shewmr4_0778 nhaD -239 4.3 CAATGTGATTGATATCAATAAA
Shewmr4_1606 icd -208 3.9 AAATGTGATCTACGCCTAAATG
Shewmr4_2960 rpsT -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewmr4_1239 cydA -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewmr4_0782 SO0939 -383 4.3 TACTGTGATCCCGTTAACCCAA
Shewmr4_0782 SO0939 -217 4 TAATGTGCGTTGATGCACATTG
Shewmr4_0273 moaA -187 3.9 TTGGGTGAGCGCTGTCACAGTT
Shewmr4_3791 SO4606 -318 4.2 AGAAGTGATCTTGATCAATTTT
Shewmr4_0619 sel1 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewmr4_1407 fadI -135 3.9 AAGTTAGAATCAGATCACACTT
Shewmr4_0857 SO3699.1 -166 4.3 AAGTGTTATGCCTATCCCATAT
Shewmr4_0481 SO4003 -159 4.3 TTTTATGATATTTTTCATATTG
Shewmr4_1398 putP -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewmr4_0299 SO1414 -263 4 AATCGGGATTAAGCTCACATCA
Shewmr4_0403 fdrC -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewmr4_0152 pckA -149 3.8 CTCAATGATCCAGCTCACACTT
Shewmr4_2587 SO1689 -96 4.5 AAGTGTGATACTTGCCACAAAA
Shewmr4_0618 crp -174 3.5 TTAGTTGACTAATATCACTAAA
Shewmr4_3020 purT -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewmr4_2506 mtrD -295 4.4 TTATGTGACAAAAATCTCAATG
Shewmr4_2506 mtrD -172 4.3 AAGTGAGAACAAGATCACACTT
Shewmr4_3715 null -225 3.8 ATGCGTGATCCGTCGCAATTAT
Shewmr4_2006 ccoN -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewmr4_3035 SO1064 -56 4.3 AACTGTGATTAATCTCACTCTA
Shewmr4_3227 Shewana3_0734 -130 4 TCCAATGATCCAGATCACATTT
Shewmr4_3843 null -95 4.4 AAAAGCGACTCAGTTCACAATT
Shewmr4_0611 astC -142 4 AACTGGTATTTTGATCACAATT
Shewmr4_0231 ccmA -222 4.2 TTTTGTGATTAGAATCTCAGCA
Shewmr4_2291 hmgA -144 3.9 TTTTTAGATTGAGATAACAGAT
Shewmr4_2291 hmgA -88 3.9 AATTGATAAGAAGATCACACTA
Shewmr4_2257 null -65 4.9 TTTTGTGATCTTAATCACTGTA
Shewmr4_2377 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Shewmr4_2426 SO2806 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewmr4_2604 fahA -196 5.1 AAATGTGATTTTGCTCACGCTA
Shewmr4_3765 null -99 5.2 AAATGTGATCTATGTCAAAAAA
Shewmr4_0445 purH -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewmr4_0488 mccA -133 4.4 TAATGTGCTCTAGCTCAGGTTT
Shewmr4_1148 SO3406 -278 4.8 ATTTGTGACAAATTGCACATTA
Shewmr4_1148 SO3406 -205 4.1 ATTCGTTAGGGATCTCACAGAT
Shewmr4_0488 mccA -328 3.8 GAATGTGATCTGTCTCGGCATT
Shewmr4_3073 cobA -248 4.2 TTATGTGAGGTGACGCAAGTTT
Shewmr4_3777 cymA -308 4.3 AAATGTCGTCTTGATCACATTT
Shewmr4_0303 SO1410 -108 4.4 TGCCGTGATCCAATTCACCTTT
Shewmr4_0303 SO1410 -68 4.1 TATTGTTAGTCACGTAACAATA
Shewmr4_0436 yniC -315 3.9 AAGTATGAATCAGGTCACACTC
Shewmr4_3034 fkpA -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewmr4_2183 hemB-1 -217 4 GTTTGTGATCGCCATCACTAAC
Shewmr4_1948 Sama_2599 -86 4.6 TGCTTTGATTTACATCACAATT
Shewmr4_0403 fdrC2 -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewmr4_3730 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Shewmr4_2719 SO1539 -127 4.5 AATAGTGAGCAATATCACGATT
Shewmr4_3074 swp_4060 -203 3.9 AAACTTGCGTCACCTCACATAA
Shewmr4_2806 SO1389 -150 4.2 AAATGTTATCTTTATCACTCAG
Shewmr4_2807 SO1388 -233 4.2 CTGAGTGATAAAGATAACATTT
Shewmr4_0389 cyaA -92 4.7 AAGTGTGACGAACTTCTCATTT
Shewmr4_0389 cyaA -52 3.9 AAGTGTTAACATGAGCACACTT
Shewmr4_3714 SO4503 -91 4 AATTGCGACGGATCACGCATTT
Shewmr4_3714 SO4503 -187 4 TTGTTTGAGGTGGATCATCAAA
Shewmr4_3906 engB -96 4.7 TAATGTGATCGGGGTAATATTT
Shewmr4_1132 yfiA-2 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewmr4_1822 hyaA -166 3.9 AAATTAGATCTGCATCATGTTA
Shewmr4_1822 hyaA -106 4.2 ATTCTTGATATGCATCAAGAAT
Shewmr4_0652 SO3987 -83 4.1 TCTTGTGACCTAGTTCACGCCT
Shewmr4_1834 rplY -255 4.1 AAGTGTGATCAAGATCGCGTGT
Shewmr4_1834 rplY -234 4.3 TTTTTTGATTCAGATCAAAGAC
Shewmr4_3123 SO3776 -141 4.2 CAATGTGAGCGGCTTCAAATTG
Shewmr4_0402 frdC1 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
Shewmr4_3907 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewmr4_0985 lipB -74 5.2 AAATGTGATCTGTCTTACATTT
Shewmr4_0361 ilvC -86 4.3 TATAGTGATTTCAATCACAACC
Shewmr4_2502 SO1787 -151 3.7 AACTGAGATCCTGATCACACCG
Shewmr4_2974 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr4_2607 phhA -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewmr4_0779 cadC -118 4.5 TTTATTGATGCATTTCACAGAT
Shewmr4_2177 fadD1 -155 5.1 TTATGTGATGATGATCAAAATT
Shewmr4_2417 SO2797 -101 4.7 TTATGCGAGCGGAATCACATTT
Shewmr4_2734 lldP -263 4.1 TCGAGTGACATAGATCACAGTT
Shewmr4_2734 lldP -181 4.2 CAAAATGATCTAGATCATATTA
Shewmr4_3188 sfcA -66 3.9 TTACGTGACTTACAGCACGTCT
Shewmr4_1141 null -85 5 AGATGTGACTTGCCTCACAATT
Shewmr4_3715 null -131 3.9 TTTGATGATCCACCTCAAACAA
Shewmr4_3654 SO0319 -66 4.6 TTTTGTGAAACGTTTCACTATT
Shewmr4_1833 SO2111 -100 3.9 GTCTTTGATCTGAATCAAAAAA
Shewmr4_1833 SO2111 -79 4.3 ACACGCGATCTTGATCACACTT
Shewmr4_0873 null -166 3.7 TGACGTGATTTGTGGCGTATAA
Shewmr4_1823 resA -266 4.2 ATTCTTGATGCATATCAAGAAT
Shewmr4_0583 SO0584 -156 4.4 TTTTGTTACTCATCGCACATTT
Shewmr4_0658 narQ -139 3.7 AAGTTTGCGCTAGATCAAAATG
Shewmr4_0658 narQ -116 4.5 AATAGTGTTGTTGTTCACACTT
Shewmr4_2124 fumB -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewmr4_2761 Sputcn32_1245 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewmr4_1036 tsx -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewmr4_2505 feoA -276 5 AAGTGTGATCTTGTTCTCACTT
Shewmr4_0018 fadB -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewmr4_0081 Sbal_4271 -53 5 AAATGTGACGCGGATCACTTAT
Shewmr4_1156 SO3395 -261 4.2 AGTTGTGATCTTTGGCGCGTAT
Shewmr4_0582 bfd -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewmr4_0298 SO1415 -241 3.8 ATTCGTGAGTTATCTCGTGAAT
Shewmr4_0298 SO1415 -94 4 TGATGTGAGCTTAATCCCGATT
Shewmr4_1038 deoA -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewmr4_2909 SO1278 -249 3.7 TATTGTGAGTTAGGTCATGTCG
Shewmr4_2909 SO1278 -60 4.1 AAAAATGAACTAGATCAAAATA
Shewmr4_3002 SO3588 -292 3.8 AAGTTTGAACCTTAGCAAAATT
Shewmr4_0094 Shewana3_0095 -80 4.8 AAATTTGAGCTTGATCACACTA
Shewmr4_3245 SO3914 -134 4.5 TAATGTGACAAAGATTAAATTA
Shewmr4_2868 SO1328 -109 4 AAAATCGATTTTGCTCACACTA
Shewmr4_3509 kefA -94 4.3 TTACATGATACGCTTCACAATG
Shewmr4_3728 Shewana3_3924 -304 4.6 TTTTGCGATCCGCCTCACAATC
Shewmr4_2182 SO2586 -177 4.2 GTTAGTGATGGCGATCACAAAC
Shewmr4_1059 SO1247 -273 4.3 CAATGTGAGCTAGTTAACATCA
Shewanella sp MR-7
Shewmr7_3622 fdrC -76 3.9 ATTTGTGAGCGATATTAATTTT
Shewmr7_3428 petA -132 3.7 CACTATGATCTGCTTCTAATTT
Shewmr7_3245 nhaD -239 4.3 CAATGTGATTGATATCAATAAA
Shewmr7_2791 icd -149 4.7 AATCGTGATATTGCTCACTATT
Shewmr7_0507 psrA -273 4 CTTATTGATCTTATTCACGATT
Shewmr7_2953 Shewmr4_2871 -55 4.3 AATAGTGATTTTTATTGCAAAT
Shewmr7_2388 cctA -184 4.4 TTACATGATGCAGCGCACATTT
Shewmr7_3419 astC -308 3.8 AATTGTGTAGTTATTCATATTC
Shewmr7_0613 argR -266 4.5 ATGTGTGACATGGATCTAATTT
Shewmr7_2496 SO2806 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewmr7_0443 Sputcn32_0539 -94 4.3 TTACATGATACGCTTCACAATG
Shewmr7_0906 hemG -318 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewmr7_3592 acnB -66 4.1 GAGTGTGACCTGATTCATACTT
Shewmr7_3487 SO0544 -145 4.1 TTTTGTGATTAAGCGCATAACT
Shewmr7_3488 SO0543 -191 4 AGTTATGCGCTTAATCACAAAA
Shewmr7_0454 null -93 4.3 TTAATTGACCTAGATCAAACTT
Shewmr7_0454 null -187 4.2 AACATTGAACTAGATCACAATT
Shewmr7_0444 SO4138 -96 4.2 CATTGTGAAGCGTATCATGTAA
Shewmr7_2448 Swoo_2741 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewmr7_2536 SO1821 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewmr7_0295 ygbA -97 4.1 TTTTGTGCGCATCTTCATAAAT
Shewmr7_1440 SO3120 -186 4.3 AAACGCGATCTTTATCACTATT
Shewmr7_4014 SO4743 -116 4.3 AAACTTGATCTAAGTCACGCTA
Shewmr7_1221 yfiA-1 -142 5 TTTTTTGATAAATCTCACATTT
Shewmr7_0227 scyA -234 4 CAATTTGATGTGGTTCCAATAA
Shewmr7_0227 scyA -125 3.7 CGCTGAGATTCTAATCACAAAA
Shewmr7_0235 ppc -184 4.3 TATCGTGATTAGTTGCATATAA
Shewmr7_0235 ppc -228 3.7 AATATTGCGTTAGCTCGCATTT
Shewmr7_0093 hutC -142 4.1 TTATGTGAGCTAGCTTGTATTT
Shewmr7_2914 hcp -124 3.6 CAAGGTGATCTCTCTCTAAGAT
Shewmr7_2481 cdd -82 4.1 AAACGCGAACTAACTCGCATTT
Shewmr7_3800 SO4519 -236 4.1 TTTTGTTAAGCAGATCATGTTT
Shewmr7_0988 Sbal_2136 -84 4.9 ATTTGTTACATTTATCACATAA
Shewmr7_3839 Sbal_0179 -287 3.8 AGTTAAGATACAGAGCACATTA
Shewmr7_3839 Sbal_0179 -92 4 ACTTGAGACTAGTTTCACATTA
Shewmr7_0017 pepQ -255 4.4 CTTTGTGATACACTGCACAAAG
Shewmr7_0614 mdh -46 4.3 AAATTAGATCCATGTCACACAT
Shewmr7_1580 SO2858 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewmr7_3999 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewmr7_0815 SO3811 -142 4.1 AATTGTTAAGTATTTCATATTG
Shewmr7_2889 SO1389 -150 4.5 AAATGTTATCTTTATCACTCAA
Shewmr7_2723 null -136 4.1 TTCCTTGATTTAGATCACACTC
Shewmr7_3363 nrfA -131 3.9 AAGTGTGAACAACAACACTATT
Shewmr7_3363 nrfA -108 4.1 CATTTTGATCTAGCGCAAACTT
Shewmr7_2839 Sputcn32_1245 -255 4.3 AGATGTGATCTAGATCGGCTTA
Shewmr7_3041 mviN -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewmr7_0372 SO4232 -201 4.6 AAAAGTGATTTATCTCACTAAA
Shewmr7_1441 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewmr7_0939 SO1064 -56 4.3 AACTGTGATTAATCTCACTCTA
Shewmr7_2949 cyaC -162 4.4 TGGATTGATCCAGATCACAAAT
Shewmr7_3838 null -99 5.2 AAATGTGATCTGTGTCAAAAAA
Shewmr7_0448 SO4131 -199 4.1 TTATGTGATTTTCACAACAACA
Shewmr7_3597 lpdA -113 4.7 TATTGTGATCAGTATCAAACAC
Shewmr7_2463 null -125 4.1 AATTGTGCCGGATATCACTTTC
Shewmr7_0828 SO3797 -53 4.5 TTTTGTTATACTCGTCACCTTT
Shewmr7_2578 mtrC -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewmr7_0446 SO4134 -205 4 AAGTGTGAGCCAGATCTAACTC
Shewmr7_0446 SO4134 -91 4.6 AATATTGATCCAAATCACGTTT
Shewmr7_0827 Sputcn32_0834 -156 4.2 AAAGGTGACGAGTATAACAAAA
Shewmr7_3047 phk -95 4.3 AATTTGGATGTAGAACACATTT
Shewmr7_3355 SO3967 -125 4.5 TTAAGTGATCTTGGCCACAATA
Shewmr7_3935 prlC -136 4.3 AATTGTGAACTGAGTCGCTTTT
Shewmr7_3056 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr7_1636 yceI -103 4.8 TTAGGTGATCTTTGTCACAAAT
Shewmr7_1463 putP -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewmr7_1867 gloA -153 4.8 CAAAGTGATACAGCTCACATTA
Shewmr7_0974 nqrA-2 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewmr7_3638 hemC -132 4.3 AAATGAGAAGTTCGTCACACTT
Shewmr7_3587 SO0439 -77 3.8 AAGCGTGAACTTAAGCACACTC
Shewmr7_2223 fadE2 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewmr7_1203 yfiA-2 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewmr7_2075 null -319 5.2 AAGTGTGACGTGTGTCACATTT
Shewmr7_2075 null -275 4.3 AAATGTTATTTTATTAACAGTA
Shewmr7_1212 swp_3747 -85 4.4 GGATGTGACTTGCCTCACAATT
Shewmr7_0763 SO3895 -309 3.9 AAATGTGATCTGGATCATTGGA
Shewmr7_3056 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr7_2028 Sama_2599 -86 4.6 TGCTTTGATTTACATCACAATT
Shewmr7_3056 SO3553 -70 4.5 TTTTGTAACTATGATCACACAA
Shewmr7_0898 swp_4060 -204 4 AAACTTGCATCAGCTCACATAA
Shewmr7_0840 cydD -167 4.5 TTTTGTGAATAGGCTAACAAAA
Shewmr7_0940 fkpA -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewmr7_0128 SO0141 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Shewmr7_0766 SO3890 -198 4.3 CCCTGTGATCTAGCTCAAATTT
Shewmr7_0443 kefA -94 4.3 TTACATGATACGCTTCACAATG
Shewmr7_3457 SO0572 -102 4.5 TATTTTGACGCATGTCAAAATT
Shewmr7_2819 Shewana3_2910 -271 4.5 TAATGTTAGCCTCCTCACACTT
Shewmr7_3304 serA -143 3.9 TTATGCGATATTGTTCTAATTC
Shewmr7_1212 null -85 4.4 GGATGTGACTTGCCTCACAATT
Shewmr7_2674 phhA -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewmr7_1757 ycbW -63 3.8 TATTTTGATATTGAATAAAATA
Shewmr7_1757 ycbW -34 3.7 TGATGTGCGAGTGTTCAAATAG
Shewmr7_1757 ycbW -2 4 TTATGTTATTATTGCCACAAAA
Shewmr7_2445 SO2753 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewmr7_1471 SO3090 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewmr7_3880 yhgI -128 4.1 AAGCGTGATGGATTTTGCAAAA
Shewmr7_0447 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Shewmr7_0448 SO4131 -157 3.8 AATTGTAAATTTTTGCATATAT
Shewmr7_2569 miaE -150 4.1 CGGTGTGATCAGGATCTCAGTT
Shewmr7_0850 SO3774 -131 4.4 TATAGTGTTGTCCGTCACATTT
Shewmr7_2260 hemB-1 -193 4 GTTTGTGATCGCCATCACTAAC
Shewmr7_2680 mtrF -202 4 ATTTGTTACCCACCTCTTATTT
Shewmr7_1681 icd -208 3.9 AAATGTGATCTACGCCTAAATG
Shewmr7_3042 rpsT -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewmr7_1310 cydA -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewmr7_3428 petA -103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewmr7_1867 gloA -205 4 TTTTGTGAGCAAGAGCTAAATA
Shewmr7_3241 SO0939 -383 4.3 TACTGTGATCCCGTTAACCCAA
Shewmr7_3241 SO0939 -217 3.9 TAATGTGCGCAGGCACACATTG
Shewmr7_3748 moaA -187 3.9 TTGGGTGAGCGCTGTCACAGTT
Shewmr7_3864 SO4606 -317 4.2 AGAAGTGATCTTGATCAATTTT
Shewmr7_3411 sel1 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewmr7_1472 fadI -135 3.9 AAGTTAGAATCAGATCACACTT
Shewmr7_1204 SO3421 -241 4.9 AAACGAGATCTAAATCACATTT
Shewmr7_3165 SO3699.1 -166 4.3 AAATGTTACGCCTATCCCATAT
Shewmr7_3549 SO4003 -159 4.2 TTTTATGATACTTTTCATATTG
Shewmr7_0441 SO4142 -122 4 GAAGGTGATACACCTCAAATAA
Shewmr7_0761 omp35 -67 3.7 AAATGTGTAAAACCACACAAAA
Shewmr7_3412 crp -174 3.5 TTAGTTGACTAATATCACTAAA
Shewmr7_2574 mtrD -295 4.4 TTATGTGACAAAAATCTCAATG
Shewmr7_2574 mtrD -172 4.3 AAGTGAGAACAAGATCACACTT
Shewmr7_3786 null -225 3.8 ATGCGTGATCCGTCGCAATTAT
Shewmr7_3786 null -131 3.9 TTTGATGATCCACCTCAAACAA
Shewmr7_1101 tsx -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewmr7_1969 ccoN -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewmr7_3240 cadC -246 3.8 CAATGTGTGCCTGCGCACATTA
Shewmr7_0762 Shewana3_0734 -130 4 TCCAATGATCCAGATCACATTT
Shewmr7_3936 null -95 4.4 AAAAGCGACTCAGTTCACAATT
Shewmr7_2329 null -65 4.9 TTTTGTGATCTTAATCACTGTA
Shewmr7_3749 etfD -175 4.3 AACTGTGACAGCGCTCACCCAA
Shewmr7_0226 ccmA -222 3.9 TTTTGTGATTAGAATCTCAGCG
Shewmr7_2363 hmgA -88 3.9 AATTGATAAGAAGATCACACTA
Shewmr7_2449 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Shewmr7_2671 fahA -196 5.1 AAATGTGATTTTGCTCACGCTA
Shewmr7_2654 SO1689 -96 4.6 AAGTGTGATATTTGCCACAAAA
Shewmr7_3584 purH -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewmr7_3785 SO4503 -187 4 TTGTTTGAGGTGGATCATCAAA
Shewmr7_3785 SO4503 -91 4 AATTGCGACGGATCACGCATTT
Shewmr7_1648 ydhD -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewmr7_1219 SO3406 -278 4.8 ATTTGTGACAAATTGCACATTA
Shewmr7_1219 SO3406 -205 4.1 ATTCGTTAGGGAACTCACAGAT
Shewmr7_3542 mccA -328 3.8 GAATGTGATCTGTCTCGGCATT
Shewmr7_3542 mccA -133 4.4 TAATGTGCTCTAGCTCAGGTTT
Shewmr7_0899 cobA -248 4.2 TTATGTGAGCTGATGCAAGTTT
Shewmr7_3850 cymA -318 4.5 AAATGTAGTGTTGATCACATTT
Shewmr7_3593 yniC -315 3.9 AAGTATGAATCAGGTCACACTC
Shewmr7_3101 purT -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewmr7_1647 sodB -91 4.3 AACAATGATTCACATCACAAAT
Shewmr7_3801 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Shewmr7_2790 SO1539 -127 4.5 AATAGTGAGCAATATCACGATT
Shewmr7_2222 SO2535 -193 4.4 TTTGTTGATTGCGATCACAATT
Shewmr7_3317 napD -149 3.9 AACTTTGATCCCGATCGACTAT
Shewmr7_2890 SO1388 -233 4.5 TTGAGTGATAAAGATAACATTT
Shewmr7_3637 cyaA -92 4.7 AAGTGTGACGAACTTCTCATTT
Shewmr7_3637 cyaA -52 3.9 AAGTGTTAACATGAGCACACTT
Shewmr7_3998 engB -96 4.7 TAATGTGATCGGGGTAATATTT
Shewmr7_2155 hyaA -166 3.9 AAATTAGATCTGCATCATGTTA
Shewmr7_2155 hyaA -106 4.2 ATTCTTGATATGCATCAAGAAT
Shewmr7_3370 SO3987 -83 4.1 TCTTGTGACCTAGTTCACGCCT
Shewmr7_0460 SO4118 -312 4.2 TATTGTAATTTAATCAACATTT
Shewmr7_3913 Sputcn32_3857 -316 4.5 TTTTCTGACACCGCTCACATTA
Shewmr7_2143 rplY -255 4.1 AAGTGTGATCAAGATCGCGTGT
Shewmr7_2143 rplY -234 4.3 TTTTTTGATTCAGATCAAAGAC
Shewmr7_0844 SO3776 -30 3.8 TAACGTGTTCTACAACAAACTA
Shewmr7_3623 frdC1 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
Shewmr7_3622 fdrC2 -76 3.9 ATTTGTGAGCGATATTAATTTT
Shewmr7_3999 cytcB -95 4.4 AAATATTACCCCGATCACATTA
Shewmr7_1050 lipB -74 5.2 AAATGTGATCTGTCTTACATTT
Shewmr7_2363 hmgA -144 3.9 TTTTTAGATAGAGATAACAGAT
Shewmr7_3665 ilvC -86 4.3 TATAGTGATTTCAATCACAACC
Shewmr7_2570 SO1787 -151 3.7 AACTGAGATCCTGATCACACCG
Shewmr7_3244 cadC -118 4.5 TTTATTGATGCATTTCACAGAT
Shewmr7_2254 fadD1 -155 5.1 TTATGTGATGATGATCAAAATT
Shewmr7_2154 resA -191 4.2 TAACATGATGCAGATCTAATTT
Shewmr7_2154 resA -251 4.2 ATTCTTGATGCATATCAAGAAT
Shewmr7_2362 hmgR -148 4.6 TAGTGTGATCTTCTTATCAATT
Shewmr7_2362 hmgR -92 3.9 ATCTGTTATCTCTATCTAAAAA
Shewmr7_3638 hemC -172 4.2 AAGTGTGCTCATGTTAACACTT
Shewmr7_2487 SO2797 -88 4.8 TTATGCGAGCGAAATCACATTT
Shewmr7_2807 lldP -263 4.1 TCGAGTGACATAGATCACAGTT
Shewmr7_2807 lldP -181 4.2 CAAAATGATCTAGATCATATTA
Shewmr7_0778 sfcA -66 3.9 TTACGTGACTTACAGCACGTCT
Shewmr7_2200 fumB -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewmr7_3055 SO3552 -165 4.4 TTGTGTGATCATAGTTACAAAA
Shewmr7_2144 SO2111 -100 3.9 GTCTTTGATCTGAATCAAAAAA
Shewmr7_2144 SO2111 -79 4.3 ACACGCGATCTTGATCACACTT
Shewmr7_3149 null -166 3.7 TGACGTGATTTGTGGCGTATAA
Shewmr7_0289 SO0318 -267 4.4 ATGTGTGAATAGGGTCAAATAT
Shewmr7_0290 SO0319 -66 4.6 TTTTGTGAAACGTTTCACTATT
Shewmr7_0292 SO0321 -25 3.8 TAGCGTGTTTTTCATCGAATTT
Shewmr7_0016 fadB -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewmr7_0840 cydD -187 4.4 TTTATTGATCTTTATCTCATTT
Shewmr7_3447 SO0584 -156 4.4 TTTTGTTACTCATCGCACATTT
Shewmr7_3364 narQ -139 3.7 AAGTTTGCGCTAGATCAAAATG
Shewmr7_3364 narQ -116 4.5 AATAGTGTTGTTGTTCACACTT
Shewmr7_2680 mtrF -202 4 ATTTGTTACCCACCTCTTATTT
Shewmr7_2839 Sputcn32_1245 -255 4.3 AGATGTGATCTAGATCGGCTTA
Shewmr7_0147 pckA -149 3.8 CTCAATGATCCAGCTCACACTT
Shewmr7_2573 feoA -276 5 AAGTGTGATCTTGTTCTCACTT
Shewmr7_2573 feoA -153 4.4 CATTGAGATTTTTGTCACATAA
Shewmr7_0079 Sbal_4271 -53 5 AAATGTGACGCGGATCACTTAT
Shewmr7_1227 SO3395 -260 4.2 ACTTGTGATCTTTAGCGCGTAT
Shewmr7_3448 bfd -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewmr7_3083 SO3588 -292 3.8 AAGTTTGAACCTTAGCAAAATT
Shewmr7_2991 SO1278 -249 3.7 TATTGTGAGTTAGGTCATGTCG
Shewmr7_2991 SO1278 -60 4.1 AAAAATGAACTAGATCAAAATA
Shewmr7_1103 deoA -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewmr7_0089 Shewana3_0095 -80 4.8 AAATTTGAGCTTGATCACACTA
Shewmr7_0697 SO3914 -134 4.9 TAATGTGATATGTATTAAATTA
Shewmr7_2950 SO1328 -109 4 AAAATCGATTTTGCTCACACAA
Shewmr7_3799 Shewana3_3924 -304 4.6 TTTTGCGATCCGCCTCACAATC
Shewmr7_2259 SO2586 -178 4.2 GTTAGTGATGGCGATCACAAAC
Shewmr7_1131 SO1247 -273 4.3 CAATGTGAGCTAGTTAACATCA
Shewanella baltica OS155
Sbal_0219 SO4520 -172 4.4 AAACATGATCTGCTTAACAAAA
Sbal_3564 SO3890 -196 3.7 CTCTGTGATCTTGGTCGTATTC
Sbal_1221 yfiA-2 -77 5.2 AAATGTGATCTAGATCTCGTTT
Sbal_1793 cctA -184 4.4 TTACATGATGCAGCGCACATTT
Sbal_1179 SO1326 -293 3.9 AATAGTGATTTTTATTGCAAAC
Sbal_1179 SO1326 -225 4.2 TGATGTGAGCAATATCTCAATG
Sbal_1179 SO1326 -193 4.3 TAATTTGAGGATGCGCACATTT
Sbal_0608 argR -270 4.5 ATGTGTGACATGGATCTAATTT
Sbal_0571 astC -142 4.1 AACTGGTATTTTGATCACATTT
Sbal_3855 SO4138 -97 4.3 ATGTGTGAAGCGTATCATGTAA
Sbal_2639 SO2858 -75 4.2 AGTCGTGATTGTGCTCACACCA
Sbal_3856 Sputcn32_0539 -95 4.5 TTACATGATACGCTTCACACAT
Sbal_3400 hemG -316 4.4 TTTTGTGAGACAGTTAAAACTA
Sbal_3905 acnB -66 4.1 GAGTGTGACCTGATTCATACTT
Sbal_0502 SO0544 -145 4.7 TTTTGTGATTGAGAGCACAACA
Sbal_0501 SO0543 -201 4.8 TGTTGTGCTCTCAATCACAAAA
Sbal_0501 SO0543 -88 3.9 AATTTTACCCTGATTCACAAAA
Sbal_3847 null -90 4.3 TTAATTGACCTAGATCAAACTT
Sbal_1738 Swoo_2741 -183 4.6 AAATGTGATATTGGTCTTAAAT
Sbal_1239 yfiA-1 -222 4.2 TTTTGTGATTGATTTATTATTA
Sbal_1239 yfiA-1 -144 4.3 CTTCTTGATGGCGGTCACATTT
Sbal_1631 SO1821 -143 4.5 TTTTGTGATGTTAATCGACATA
Sbal_4067 ygbA -96 4.1 TTTTGTGCGCACCTTCATAAAT
Sbal_2793 SO3120 -202 4.3 AAACGCGATCTTTATCACTATT
Sbal_0229 scyA -228 3.9 CAATATGATGTGGTTCCAATAA
Sbal_0229 scyA -128 4.5 TGTTGAGATTCTAATCACAAAA
Sbal_1783 ydhD -156 4.5 ATTTGTGATGTGAATCATTGTT
Sbal_0179 Sbal_0179 -173 4 CAAATTTATCTTTATCACATTT
Sbal_0179 Sbal_0179 -89 4.7 AGTTGAGATATGTTTCACATTA
Sbal_4253 hutC -177 4.1 TTATGTGAGCTAGCTTGTATTT
Sbal_1216 hcp -124 4.1 TAAGGTGATCGTTCTCTAATAT
Sbal_1694 cdd -157 3.8 ATTCGTGAATAGACTCACTCTA
Sbal_1694 cdd -82 4.2 AAACGCGAGCTAACTCGCATTT
Sbal_0220 SO4519 -228 4.1 TTTTGTTAAGCAGATCATGTTT
Sbal_2136 Sbal_2136 -169 3.7 TGCTGTGAGCTTTCTCTTAAAT
Sbal_2136 Sbal_2136 -89 4.5 ATATGTTATCCGAATCACTAAA
Sbal_0022 pepQ -302 4.2 CTTTGTGATACACTGCACAGAG
Sbal_0609 mdh -46 4.3 AAATTAGATCCATGTCACACAT
Sbal_0711 ampG -218 4.4 TTTTGTGATCTCTTTTACTCAA
Sbal_0051 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sbal_3085 SO1388 -234 4.2 TTTTATGCTAAGAATCACACAA
Sbal_0283 etfD -170 4.4 ATCTGTGACAGTCCTCACCTAA
Sbal_0794 nrfA -149 4.4 AAATGTGAACAACAACACCTTT
Sbal_0794 nrfA -126 4.1 CATTTTGATCTAGCGCAAACTT
Sbal_4555 gloA -196 4 TTTTGTGAGCGACAGCCAATTT
Sbal_0924 nqrA-2 -128 4.3 CAGCGTGATTGCGATCGCATTT
Sbal_1230 swp_3747 -78 5.5 AAATGTGATTAAGTTCACAATT
Sbal_1034 SO3556 -139 3.8 TGATATGAAATTGTTCGCAGTT
Sbal_1034 SO3556 -95 4.1 TTTCGTTATATACTTAACAGAA
Sbal_2305 SO2535 -193 4.4 TTTGTTGATTGCGATCACAATT
Sbal_3098 Sbal_3098 -154 4.2 AATAATGATTTAATTCAAACTA
Sbal_2770 putP -102 3.8 AGGTTAGATTTTAATCACACTT
Sbal_0385 SO4240 -176 4.3 ATAAGTGATCGATTCCACAGAA
Sbal_1589 mtrC -190 3.5 TAGAAAGATCCAAGTCACACAT
Sbal_1597 SO1787 -156 4.2 AACTGAGATCCTGATCACACAG
Sbal_1046 phk -96 4.1 AATTTGGATGTAGGGCACATTT
Sbal_1046 phk -235 4.4 TCATGTGATCAAGCTCGCGTTT
Sbal_3853 SO4134 -206 3.8 AAGTGTGAACCAGATCCTAATC
Sbal_3853 SO4134 -92 5 AAGAGTGATCTAAGTCACATTT
Sbal_2614 hmgR -148 4.7 TAGTGTGATCTTGTTATCAATT
Sbal_0427 nadC -57 3.8 AAGTGTGATCTATGCCCTAAAT
Sbal_2044 null -317 5.1 AAGCGTGATCTGTGTCACATTT
Sbal_1890 resA -301 4.3 ATTCTTGATGTATATCAAGAAT
Sbal_2306 fadE2 -72 4.8 AATTGTGATCGCAATCAACAAA
Sbal_3851 SO4131 -198 4.2 TTATGTGATTTTGACAACAACA
Sbal_3936 fdrC -105 4.1 TCAATTGATCTGGCTCACGTTT
Sbal_4000 hemC -132 4.9 AAATGTGAAGTCCGTCACACTT
Sbal_0417 SO0439 -93 4.8 AAATGTGACCTAAAGCACATAC
Sbal_1782 sodB -90 4.3 AACAATGATTCACATCACAAAT
Sbal_0833 cadC -75 4 TTGGGTTAGCAAGATCACATTA
Sbal_0562 petA -102 3.7 TAATGAGCCCCGCTTCAAACTT
Sbal_0562 petA -131 3.7 CACTATGATCTGCTTCTAATTT
Sbal_2438 ycbW -2 4.2 TTATGTTATTAATGCCACAAAA
Sbal_0533 SO0572 -102 4.3 TATTTTGACTCAAGTCAAAAAA
Sbal_1478 mtrF -202 4.1 AATTGTGATGCTCATCATGGCT
Sbal_3674 SO3967 -136 4 TTGGGTGATCTGCACCACAATC
Sbal_0142 yhgI -129 4 AATCGTGATCGCTATGGCAAAA
Sbal_2615 hmgA -88 4 AATTGATAACAAGATCACACTA
Sbal_1598 miaE -149 4.3 CTGTGTGATCAGGATCTCAGTT
Sbal_3458 SO3774 -128 4.4 TATAGTGTTGTCCGTCACATTT
Sbal_3852 udp -229 3.8 GATTAGGATCTGGTTCACACTT
Sbal_3852 udp -92 4.1 TTCTGTGATCAAGTTAACCTTC
Sbal_1047 SO3541 -220 3.9 AAACGCGAGCTTGATCACATGA
Sbal_2615 hmgA -144 3.5 TTTTTAGATTGAGATAACGGAT
Sbal_1436 null -138 4.1 TTCCTTGACTTAGCTCACACTT
Sbal_4220 SO0141 -160 4.2 TTTCGTGACCTAGATTAGATAT
Sbal_2475 icd -212 3.9 AAATGTGATCTGTGCCTAAATG
Sbal_1051 rpsT -225 4.5 TTAGGTGATACATCTCAAAAAA
Sbal_2979 cydA -207 4.4 TAGTGTGACTCGCGTCTCAATA
Sbal_1889 hyaA -107 4.2 ATTCTTGATATACATCAAGAAT
Sbal_1889 hyaA -229 3.9 TTAAGTGACCGATTTCATCCAA
Sbal_1889 hyaA -167 3.7 AAATTAGATCTACGTCATGTTA
Sbal_0284 moaA -187 4 TTAGGTGAGGACTGTCACAGAT
Sbal_0154 SO4606 -317 4.4 ATAAGTGATCTTGATCAATATT
Sbal_0579 sel1 -278 4.4 TTTAGTGATTTAAGTCAACTAA
Sbal_2761 fadI -136 3.9 AAGTTAGAATCAGATCACACTT
Sbal_0765 SO0919 -280 4.1 TTTTGTGATCTAGATCCAATCC
Sbal_0765 SO0919 -139 4 ATCAGCGATCTAGATCTCAATA
Sbal_1490 ompW -158 4 TTTCGTGATTCAGCTCCCATGT
Sbal_1368 icd -149 4.7 AATCGTGATATTGCTCACTATT
Sbal_1593 mtrD -304 3.8 TTATGTGACAAAAATACCAATG
Sbal_1593 mtrD -181 4.8 AAACGTGATCAACATCACGCTT
Sbal_1741 SO2753 -233 4.7 AAAGGTGATCTATATCACTTAA
Sbal_3911 lpdA -111 4.7 TATTGTGATCAGTATCAAACAC
Sbal_4487 ccoN -173 4.5 TTTTTTGATATTGCTCAAGTAT
Sbal_2201 ccoN -173 4.5 TTTTTTGATATTGCTCAAGTAT
Sbal_3569 Shewana3_0734 -127 4.9 AAACTTGATCCAGATCACACTT
Sbal_0123 null -154 4.6 AAAAGTGAACTCGTTCGCATTT
Sbal_3502 serA -142 4.1 TTATGCGATATTGTTCTTAATT
Sbal_0228 ccmA -212 4.4 TTTTGTGATTAGAATCTCAACA
Sbal_1737 SO2757 -227 4.2 ATTTAAGACCAATATCACATTT
Sbal_2577 null -65 5 TTTTGTGATCTAAATCACTGTA
Sbal_1594 feoA -276 5 AAGCGTGATGTTGATCACGTTT
Sbal_3228 tsx -145 4.2 AGTCGCGACTTTGTTCACAATT
Sbal_1487 fahA -235 5 AAATGTGATTTTGGTCACGCTA
Sbal_3570 omp35 -67 3.6 AAATGCGTTAAACCACACAAAA
Sbal_0420 purH -195 4 TATTGTGAAATCACGCAGAAAA
Sbal_1222 SO3421 -244 5 AAACGAGATCTAGATCACATTT
Sbal_0578 crp -174 3.7 TTAGTTGACTTAAATCACTAAA
Sbal_3906 yniC -315 3.9 AAGTATGAATCAGGTCACACTC
Sbal_0942 Spea_3089 -213 4.6 TTATGTGAAGCAGATCGCCATT
Sbal_0180 null -97 5.2 AAATGTGATCGTGTTCAAAAAA
Sbal_1858 hemB-1 -168 4.4 TTATGTGATCTAAGTCAATGAT
Sbal_3936 fdrC2 -105 4.1 TCAATTGATCTGGCTCACGTTT
Sbal_3937 frdC1 -145 4.3 TTTTGTGATCTTCTTCTAAGAG
Sbal_3851 SO4131 -157 3.8 AAATGTAAATTTTTGCATATAT
Sbal_1679 SO2806 -94 4.2 ATCTGTGAATTAAGTCACACAG
Sbal_2792 null -171 4.5 AATAGTGATAAAGATCGCGTTT
Sbal_1369 SO1539 -128 4.5 AATAGTGAGCAATATCACGATT
Sbal_0051 cytcB -95 4.3 AAATATTACTCCGATCACATTA
Sbal_3742 SO4019 -239 4.5 AATAGTGATACAAACCACACTT
Sbal_3084 SO1389 -180 4.4 TTGTGTGATTCTTAGCATAAAA
Sbal_1772 yceI -105 4.7 TTAGGTGATGTGGGTCACGTTT
Sbal_3510 napD -150 4 AACTTTGATCCGGATCGACTAT
Sbal_4130 SO4503 -187 4 TAGTTTGAACTAGATCATCAAA
Sbal_0052 engB -95 4.6 TAATGTGATCGGAGTAATATTT
Sbal_1182 cyaC -101 4.7 TAGATTGATCCAGATCACAAAT
Sbal_0787 SO3987 -277 3.7 TAAAGCGATATATGTAACAAAC
Sbal_1901 rplY -247 4 CAGTGTGATCTAGATCGCGTGT
Sbal_3459 SO3776 -146 3.8 GAGTGCGAGCTAGCTCAAATTT
Sbal_3281 lipB -74 5.2 AAATGTGATCTGTCTTACATTT
Sbal_2519 sdhC -66 3.8 TGCCGTGATTCACATCCCAGTT
Sbal_4032 ilvC -85 4.3 TATAGTGATTTCAATCACAACC
Sbal_3568 SO3895 -321 5 AAGTGTGATCTGGATCAAGTTT
Sbal_3332 SO3683 -189 4.2 AGCCGTGATATTGCTCAAAAAT
Sbal_1484 phhA -75 4.7 AAGTGTGAGGGAGTTAACAAAT
Sbal_1890 resA -241 4 TAACATGACGTAGATCTAATTT
Sbal_1052 mviN -49 4.6 TTTTTTGAGATGTATCACCTAA
Sbal_1864 fadD1 -156 5.1 TTATGTGATGATGATCAAAATT
Sbal_1478 mtrF -202 4.1 AATTGTGATGCTCATCATGGCT
Sbal_1354 lldP -263 4.2 CTAAGTGATCACTGTCACAGAT
Sbal_1354 lldP -181 4 CAAGATGATCTAGATCATATTA
Sbal_0676 sfcA -55 4.4 TTACGTGACTTACAGCACGTAT
Sbal_1918 fumB -103 4.6 AAATGTGATGTAGCCCAAAAAG
Sbal_1230 null -78 5.5 AAATGTGATTAAGTTCACAATT
Sbal_4131 null -136 4.2 TTTGATGATCTAGTTCAAACTA
Sbal_1900 SO2111 -78 4 ACACGCGATCTAGATCACACTG
Sbal_3331 null -76 3.7 ATTTTTGAGCAATATCACGGCT
Sbal_3463 cydD -170 4.3 TTTTGTGAGTCTGCTAGCAAAA
Sbal_0543 SO0584 -170 4.2 TTTTGTTACATGGCGCACGTTT
Sbal_0793 narQ -121 3.7 AAGTTTGCGCTAGATCAAAATG
Sbal_0793 narQ -98 4.5 AAAGGTGTTGTTGTTCACATTT
Sbal_0124 prlC -136 4.3 AAATGCGAACGAGTTCACTTTT
Sbal_0390 SO4232 -207 4.3 AATGGTGATATTGGTCACTAAA
Sbal_2269 gloA -196 4 TTTTGTGAGCGACAGCCAATTT
Sbal_0021 fadB -210 3.7 CTCTGTGCAGTGTATCACAAAG
Sbal_3741 SO4018 -159 4.2 AAGTGTGGTTTGTATCACTATT
Sbal_4271 Sbal_4271 -57 4.6 AACTGTGATGCAGATCACTTAC
Sbal_2762 SO3090 -148 4.6 AAGTGTGATCTGATTCTAACTT
Sbal_0542 bfd -113 3.9 AAACGTGCGCCATGTAACAAAA
Sbal_3226 deoA -136 3.7 AAGTGTGACCTAAATCTATTTG
Sbal_0351 SO0355 -73 3.8 CTATTTGCGCGGGCTCACAAAA
Sbal_3856 kefA -95 4.5 TTACATGATACGCTTCACACAT
Sbal_1038 SO3552 -126 3.8 CAGTGTGATCTTGTCAGCAAAA
Sbal_3384 chaA -104 4.2 TACAGCGATCTAGCTCAAATAT
Sbal_1859 SO2586 -205 4.3 ATCATTGACTTAGATCACATAA
Sbal_3204 SO1247 -159 3.8 AATAGTGATCTTTCTCAGCATC
Shewanella denitrificans OS217
Sden_0657 SO0543 -34 3.9 TAATATGACTAGAGTCAAACAT
Sden_3377 acnB -139 4.1 CAGTGTGAGCCGATTCATACTT
Sden_3377 acnB -67 3.9 AATTGTTAGCCTTATCACTATG
Sden_1453 SO2806 -35 3.9 ATATTTTATGCCGTTCACTCAT
Sden_2091 Swoo_2741 -88 4.7 GATTGTGATCCCTCTCGCATAT
Sden_3568 scyA -131 3.8 AGCTGGGAGGCTTATCACAAAA
Sden_3568 scyA -109 4.1 AGGTGTGATTTTATTAACTTTA
Sden_1640 ydhD -137 4.5 TTTTGTGATGTGCATCATTGTT
Sden_0887 SO1388 -161 3.7 TATTGTATACAATATCACGTTA
Sden_0982 nqrA-2 -128 4.3 CAGCGTGATTGCGATCGCATTA
Sden_2731 phk -233 5 CTTAGTGATCCAGTTCACATTA
Sden_2161 hmgR -146 4.3 CGTTGTGATCTAGCTATCAATT
Sden_2731 phk -94 3.7 AAGTTAGATCGGGGACACATTT
Sden_1731 ycbW -139 4.2 ATTTATGAGTGCGATCAAAATT
Sden_2187 sdhC -186 3.8 AAGGGCGACAAACATCACAATT
Sden_1625 fadD1 -189 4.1 TTATGTGATTATGGGCCCAAAT
Sden_3048 Sputcn32_0834 -175 4 TAATGTGATTGGTATAAGAACA
Sden_0100 etfD -130 4.6 TTTTGTGACACAGCTCACCTCA
Sden_3073 SO4131 -165 3.8 ATATGTCAACAATTTCATATTT
Sden_2415 feoA -148 3.9 ATCTGCGGTATTTATCACATAA
Sden_2595 phhA -61 4.1 AATTGTGCGCCATGGCACACTA
Sden_2539 etfB -175 4.4 TCATATGATTTTCATCACACTT
Sden_0534 SO0572 -100 3.7 ATTTTTGACTAGGGTCAATATT
Sden_2589 ompW -157 4.2 TTTTGTGAATTAGATCAAGACT
Sden_2384 null -81 4.8 AAATGTGATCCAGCTCAGCTTT
Sden_2730 SO3541 -140 4.6 TAATGTGAACTGGATCACTAAG
Sden_2915 SO1059 -4 3.8 ATTCGTGAACTTGCGCAACATT
Sden_3190 crp -94 3.6 AAACACGATCTTGGTCAAAGTT
Sden_1274 cydA -157 4.1 TAAATTGATCTAAATCAATTTA
Sden_0101 moaA -186 4.3 TGAGGTGAGCTGTGTCACAAAA
Sden_3517 SO4606 -316 4.4 AAAAGTGATCTTGATCAATATT
Sden_1224 purE -315 3.7 AATTCTGACTCATCTTAAATTA
Sden_2187 sdhC -274 3.7 TGGATTGATGCAAATTACAAAA
Sden_0388 hemC -85 3.9 AAATCTGCTTTGCTTCAAACAT
Sden_3353 SO4118 -298 3.8 TCTTGTTATTTAAACAACATTT
Sden_3353 SO4118 -197 4.2 TAATGTGATGCATAGCAGCCTT
Sden_2162 hmgA -122 3.6 AATTGATAGCTAGATCACAACG
Sden_3193 astC -136 4.1 AACTGGTATTTTGATCACATTT
Sden_2745 SO3421 -291 4.7 AAGCGTGATCAAAGTCACACTT
Sden_1912 fumB -131 3.9 AAATGTGATGTAGCCCCAAAAG
Sden_2092 SO2757 -208 4.3 ATATGCGAGAGGGATCACAATC
Sden_1765 SO2535 -204 3.7 TATGATGATCCTATTCACAAGT
Sden_2784 cyaC -157 4.8 TGAATTGATCTAGATCACATTT
Sden_3569 ccmA -186 4 TTTTGTGATAAGCCTCCCAGCT
Sden_3622 cytcB -94 3.7 AAATATTATTTCGAGCATAATA
Sden_1529 fadI -109 3.9 AAGTTAGAATCAGATCACACTT
Sden_1639 sodB -106 4.3 AACAATGATGCACATCACAAAA
Sden_3378 yniC -316 4 AAGTATGAATCGGCTCACACTG
Sden_3210 null -122 4.3 AAGCGTGAACAGCATCACGTAA
Sden_0638 Sfri_4035 -116 4 TTCTTTGATGTTAATCAAGCAT
Sden_3622 cytcB -94 3.7 AAATATTATTTCGAGCATAATA
Sden_3621 engB -182 3.8 TATTATGCTCGAAATAATATTT
Sden_1528 SO3090 -157 4.6 AAGTGTGATCTGATTCTAACTT
Sden_3074 udp -92 4.4 AACTGTGATGAAGTTAACCAAA
Sden_1851 ccoN -182 4.7 TTTTTTGATGTAGCTCAAGTAT
Sden_2592 fahA -107 4.7 AAATGTGATTTTGCGCACGCTA
Sden_2561 icd -143 3.8 AAAAGGGATATTTCTCACTAAT
Sden_1764 fadE2 -66 3.8 ACTTGTGAATAGGATCATCATA
Sden_2746 yfiA-2 -77 4.8 AAGTGTGACTTTGATCACGCTT
Sden_2746 yfiA-2 -38 4.1 TAATCTGAAGTTAAGCACATAA
Sden_1024 tsx -145 4 AGTCACGATATTGTTCACATAT
Shewanella frigidimarina NCIMB 400
Sfri_0456 frdC1 -103 3.8 ATAGGTGAACATTATCACGGTT
Sfri_2793 lldP -298 4.3 TCTAGTGAGCCCCTTCACATTA
Sfri_2179 gloA -101 4.6 AAATGTGAACTAAAGCAAAATT
Sfri_3534 SO0543 -200 4 ATATTTGATCACAAGCACACTC
Sfri_1546 SO2858 -237 4.9 TTTTGTGATGCAGATCTCAATC
Sfri_0813 hemG -144 4 TTTTGCGCGGCAGTTCACATTG
Sfri_0813 hemG -83 4.4 TGACGTGATCTGTTTCATGTAA
Sfri_3771 acnB -139 4.6 TAGTGTGAGCTGATTCATACTT
Sfri_3603 SO1821 -307 4.4 AGTCGCGATCTACATCAAATAA
Sfri_3603 SO1821 -140 4.2 TTATATGAGATATATCGCCTTT
Sfri_4042 SO4743 -116 4.7 ATTTTTGATATATATCACAGTC
Sfri_0180 scyA -233 3.9 CAATTTGATATGGTTCCAAAAT
Sfri_0180 scyA -133 4.1 AGCTGAGATTGTTATCACAAAA
Sfri_1637 cdd -44 3.8 AAATTTTATTTTTATCCAATTT
Sfri_3173 mdh -45 4.2 AATTTAGATCTATGTCACAAAC
Sfri_1504 null -250 4 TTACATGATATAGCGCACATCT
Sfri_1870 SO2535 -203 3.9 ATTATTGATCTCATTCACAAGA
Sfri_0937 SO3683 -146 3.9 CTTAGTGATCAAAATCAAATCA
Sfri_0225 Sputcn32_3857 -184 4.3 ATAAGTGCTATTAGTCACAAAT
Sfri_2343 sucA -19 3.7 AAGTTTGAAAGGAATAACAATG
Sfri_3404 SO4134 -219 4.7 TAACGTGATTTACATCAAGTTA
Sfri_3404 SO4134 -81 3.8 CATTGTTATTGGAATAACATCT
Sfri_2779 icd -148 4.7 TAATGTGATAATACTCACTATT
Sfri_2325 hmgR -135 5.1 ATATGTGATCTAACTTACAATT
Sfri_2271 Sfri_2271 -125 4.1 TTTTATGACTTAGGTCAACTTA
Sfri_3674 SO3553 -116 4.5 TAATGTGATGATAATTATATTA
Sfri_0553 napA -142 4.3 AAATGTGACCTTGCACAACTAT
Sfri_3403 udp -244 4.7 TAACTTGATGTAAATCACGTTA
Sfri_3874 prlC -226 4 AATTGGGATCTTAGTCACTCTA
Sfri_2416 null -149 5 AAATGTGATGTTGTTCACATGT
Sfri_2793 lldP -197 3.7 AAACGTGACCTCAAACACGCAC
Sfri_3403 udp -92 4.8 ATATGTGATCAAGTTAACCTTA
Sfri_0949 nqrA-2 -127 4.3 CAGCGTGATTATGATCGCATTT
Sfri_0491 SO0439 -135 5.2 TTTTATGATTTAGATCACAAAA
Sfri_2098 gloA -213 3.8 AAACGTTAAATCCATTACATTA
Sfri_3632 cadC -156 5 TGACGTGATATCGCTCACAAAT
Sfri_3632 cadC -234 4.3 TTTCATGATGTAAGTCTCATTA
Sfri_3632 cadC -334 4.6 AAATGTGATTCAAAGCAGATAA
Sfri_3674 SO3553 -116 4.5 TAATGTGATGATAATTATATTA
Sfri_3816 SO4232 -169 4.9 AAGTTTGATCATGATCACAATT
Sfri_0052 null -125 4.2 TTTCGGGATCTAGTTCAAAGTT
Sfri_0553 napA -166 4.2 AAATGAGATTTACATCACGCTG
Sfri_3402 SO4131 -287 3.7 CATAGTGATATTCGTTAAAATT
Sfri_3402 SO4131 -243 3.7 CTTTATGCGTTGCATCACACTA
Sfri_3510 SO0572 -237 4.2 CATTGTGATCAATGTCATATCA
Sfri_2748 etfB -153 4.2 TAGTTTGATTGCCACCACAATA
Sfri_0456 fdrC -135 3.8 TTGTGTGACCCGCTTCTAACTC
Sfri_1334 ompW -232 3.9 TCGCTTGATCAACCTCACAAAA
Sfri_1334 ompW -170 3.9 TTTTGTGATCCAAATCAACAGC
Sfri_0456 fdrC -103 3.8 ATAGGTGAACATTATCACGGTT
Sfri_2416 null -4 4.1 ATTCATGAGTTCAGTCACATTA
Sfri_0507 Sputcn32_0777 -129 4.2 TTTTGTGAGCTAATTGGCAATT
Sfri_0568 SO3774 -172 3.8 TTCAGTGAACAAAATCAAACAA
Sfri_0568 SO3774 -131 4.1 TTGAGTGTCCAAGTTCACATTT
Sfri_2410 null -116 4.8 TTTTGTGATCGACTTCACGTCT
Sfri_1504 null -144 3.9 TAATTTGAGATTGTTTATAAAT
Sfri_2897 SO3541 -306 4.2 AAGTGTGATGGATATCACTTGT
Sfri_3292 crp -97 4 AAATACGATCTCTATCAAAGTT
Sfri_2257 icd -242 4.6 AATTGTGATCTGTACCTAATTT
Sfri_1001 tsx -146 4.2 AGTCGCGACATTGTTCACAAAA
Sfri_2686 putP -64 4.5 AAGTGTGAACTAGATCGAACTT
Sfri_1142 cydA -240 4.2 AAATCTAATGCTGGTCACATAA
Sfri_2898 phk -233 4.5 ACAAGTGATATCCATCACACTT
Sfri_0082 moaA -186 4.5 TAGCGTGAGTCGAGTCACAAAT
Sfri_0258 SO4606 -321 3.9 CAAAGTGATCTTGATCAATGTT
Sfri_3291 sel1 -222 4.1 AACTTTGATAGAGATCGTATTT
Sfri_3291 sel1 -147 4.3 ATTTGTGATGACGGTCGACTTT
Sfri_3291 sel1 -38 4 TTATTTAATCAGCTTCATAAAT
Sfri_2677 fadI -104 3.9 AAGTTAGAATCAGATCACACTT
Sfri_0688 SO0919 -146 4.1 ATAGTTGATTCAGAACACATTA
Sfri_3694 shew_3181 -198 4 ATATGTCATACATTTAACGTAT
Sfri_0440 hemC -167 4 AATGGTGATCATCGTAGCATTT
Sfri_3973 SO0075 -107 4 AAACGTGACCGTAAGCTCAAAA
Sfri_2950 SO1326 -128 3.9 TTTTTTGAGTTTGTGCACAACT
Sfri_0503 omp35 -145 4.5 TTATTTGATCTAGGCCACACTA
Sfri_2098 gloA -41 3.7 TTTAATGATGCGATTCAGAGAT
Sfri_3775 lpdA -168 5.1 TATTGTGATCGGTTTCAAACAA
Sfri_2010 ccoN -186 4.4 TTTTTTGACTTAGCTCAAGTAT
Sfri_0076 SO4520 -182 4.4 AAACATGATCTGCTTAACAAAT
Sfri_2103 hyaA -174 3.8 TTTTGTTAACTTGATCAACATC
Sfri_2103 hyaA -168 4.4 TAACTTGATCAACATCATAAAT
Sfri_3674 SO3553 -116 4.5 TAATGTGATGATAATTATATTA
Sfri_3875 null -148 4 TAGAGTGACTAAGATCCCAATT
Sfri_2326 hmgA -106 5 AATTGTAAGTTAGATCACATAT
Sfri_2326 hmgA -126 3.5 TTTGTTGATCTTTACCACTAAA
Sfri_3609 hcp -125 4 GAAGGTGATGTGGCTCATAAAA
Sfri_3299 astC -137 4.1 AACTGGTATTTTGATCACATTT
Sfri_0504 SO3895 -251 4 TATCTTGATGAGTTTAACCAAT
Sfri_2911 SO3421 -383 5.2 AATAGTGATCTGCATCACACTT
Sfri_1454 SO2757 -191 3.5 TTAAATAATAAGTTTCAAATAT
Sfri_2947 cyaC -158 4.4 TCTATTGATCTAAATCACAAAT
Sfri_0179 ccmA -213 4.2 TTTTGTGATAACAATCTCAGCT
Sfri_1331 fahA -116 4.1 AAATGTGATTTGGTACTTACTA
Sfri_3945 cytcB -181 4.3 AAATATTAGCCTGATCACATTA
Sfri_0493 purH -195 3.9 TATTGTGAAATCACACAGAAAA
Sfri_0404 ygbA -142 4 TTTTGCGATCCCAACCTCAAAA
Sfri_2156 fumB -122 4.6 AAATGTGATGTAGCCCAAAAAG
Sfri_3633 SO0939 -147 4.4 TTATCTGCTTTGAATCACATTT
Sfri_3633 SO0939 -325 4.5 ATTTGTGAGCGATATCACGTCA
Sfri_1748 ydhD -155 4.5 TTTTGTGATGTGAATCATTGTT
Sfri_3316 null -160 4.3 ATAAGTGATCTAGTACTCACTT
Sfri_3316 null -99 4.2 AAACATGATCTGGTTCAAATCA
Sfri_2472 Spea_1673 -298 4.1 ACTTGTTATCCAGCTCTCACTT
Sfri_3188 cobA -37 4.2 ATATTTGAACATGGTCAAATAT
Sfri_3772 yniC -288 4.3 AAGTATGAATCAGCTCACACTA
Sfri_0272 cymA -146 4.3 AGTCGAGATCTAGCTCGCATTT
Sfri_0964 Spea_3089 -141 4.5 TTTTGTGAATTAAAGCAAATAA
Sfri_4035 Sfri_4035 -131 3.8 ATATGTGACATACGCATCATAA
Sfri_3610 Sama_2599 -77 4 TTTGTTGATGTTGATCAAATTC
Sfri_0456 frdC1 -135 3.8 TTGTGTGACCCGCTTCTAACTC
Sfri_0616 null -115 3.7 TTAATTGATTACGATCAATTTA
Sfri_3945 cytcB -181 4.3 AAATATTAGCCTGATCACATTA
Sfri_1999 psrA -181 3.8 AACCGTGACATCAATCAAATCA
Sfri_3307 petA -129 3.8 CACTATGATCTGGTTCTAATTT
Sfri_0441 cyaA -129 3.8 AAATGCTACGATGATCACCATT
Sfri_0441 cyaA -100 3.9 AAATGTGATCTTGATTGGCAAA
Sfri_0051 SO4503 -139 3.7 AGATTTGCGCCAGATCACGCTT
Sfri_2778 SO1539 -313 4.7 AATAGTGAGTATTATCACATTA
Sfri_3944 engB -104 4.7 TAATGTGATCAGGCTAATATTT
Sfri_3097 fadD-2 -256 5 TTTGGTGACATAGATCACATAT
Sfri_0081 etfD -159 4.7 ATTTGTGACTCGACTCACGCTA
Sfri_0421 ilvC -85 4.1 TATAGTGACTTCAATCACAACG
Sfri_2509 swp_4930 -114 3.9 TATTGTGACATATAGATAATAT
Sfri_1747 sodB -102 4.2 AACAATGATTCACATCACAAAA
Sfri_3213 cydD -214 4.2 TATTGTGTTGCAATTAACAATG
Sfri_3213 cydD -104 5 AAATGTGAATCAGATAACATTT
Sfri_1733 fadD1 -165 4.7 TTATGTGATTATGATCGAAAAT
Sfri_3554 SO4142 -112 4 GGATATGATCTACTTCAAATTA
Sfri_1328 phhA -74 4.5 AACTGTGAGGGAGTTAACAAAA
Sfri_3189 swp_4060 -251 4.5 ATATTTGACCATGTTCAAATAT
Sfri_1869 fadE2 -67 3.8 TCTTGTGAATGAGATCAATAAT
Sfri_0833 sfcA -122 5 TAATGTGATTTTACTCACTTAA
Sfri_0938 SO3681 -133 4.1 TGATTTGATTTTGATCACTAAG
Sfri_1487 SO2589 -55 4 AAGTGTGACTAAGGTTACCATT
Sfri_2898 phk -95 3.8 AAATTAGATAAAGGCCACATTA
Sfri_2912 yfiA-2 -77 5 AAGTGTGATGCAGATCACTATT
Sfri_2637 mtrC -164 3.8 TAGGCTGATCATCATCACACAA
Sfri_0621 narQ -140 3.9 AAACAGGATGTATCTCACAGTT
Sfri_2343 sucA -74 4.1 ACGTGTGATGTAACTTACGTTA
Sfri_1948 Sbal_1323 -111 4.9 TGTTGTGATCTATATCAAGTTA
Sfri_3188 cobA -7 4.1 AAATGTGATGGAGTTAGTATCT
Sfri_3324 bfd -275 3.9 TAATCTGATCCGGCTAACACCT
Sfri_0361 SO0355 -51 4.3 TTGTGTTACCTAGCACACATAT
Sfri_0385 SO0296 -7 4.1 AAGTGTAATGAAATCCACAATA
Sfri_3630 SO3588 -313 3.8 TTTTGAGACTTATCACACCAAT
Sfri_3757 SO4118 -303 4.1 TATTGTTATTTAGACAAAATAA
Sfri_3324 bfd -253 3.8 AATATTAACCGCTTTCACAAAT
Sfri_2440 SO1482 -90 4 TTTTTTGCCACATATAACAAAA
Sfri_2678 SO3090 -167 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella amazonensis SB2B
Sama_1838 null -301 5.2 AAGTGTGATGCACGTCACAAAA
Sama_2855 SO3683 -106 4.4 ACTCGTGATCCAGATCAAGTTT
Sama_1251 SO1821 -140 4.5 TGTTGTGATTTTTAACACGTTT
Sama_1251 SO1821 -168 3.9 TTATCTGATAGAGATTTCAATT
Sama_3011 astC -142 4 AACTGGTATTTCGATCACAATT
Sama_1287 SO2806 -85 4 AATTGTGAAGCCAGTCACGGTG
Sama_2882 hemG -130 3.9 AAATGTGAGGCAGTTGGAATTT
Sama_0382 acnB -138 4 GAGTGTGAGCTGATTCATACTT
Sama_3164 SO0543 -240 3.9 CATTGTTACTCACTTCATACAT
Sama_3164 SO0543 -126 3.9 ATTTATGACCATACTCACAGAG
Sama_0895 hcp -113 3.6 TAAGATGATCTGCTTCAAGGAA
Sama_2094 Swoo_2741 -115 4.3 TTGTGTGATATTCCTCCAAATT
Sama_3326 ygbA -94 3.6 TTTTGTGCGCATCTTCATGCTT
Sama_0246 scyA -225 4 CAATTTGATGCAGTTCCAATAA
Sama_1974 cdd -82 4 AAATGGGATTAGACTCCCATTA
Sama_1375 atoB -67 4.1 AACCGCGACCGCCATCACATTT
Sama_0033 pepQ -109 4 CTTTGTGATACACTGCACAGCA
Sama_0672 mdh -46 3.8 TTTGAGGATCTACCTCACAAAT
Sama_3523 etfD -157 4.3 AATTGTGACGCCGCTCACTCAG
Sama_1068 null -192 4.2 ATGTGTGAGCTTTGGCAAATTT
Sama_0032 fadB -193 3.8 TGCTGTGCAGTGTATCACAAAG
Sama_1869 SO2535 -195 3.9 ATAAGCGATCCTGATCACAAGT
Sama_0411 SO4134 -89 4.5 CTTAGTGATCCGGATCACTTTT
Sama_3178 SO4142 -268 3.9 AAACGTCACATAGATCACACAC
Sama_0915 phk -240 4.1 ACTCGTGATCAAGCTCACGGTT
Sama_0915 phk -99 4.1 AATTTGGATGTGGGGCACATTT
Sama_0091 cytcB -95 3.7 AAATATTGCCCCGATCACATAT
Sama_2599 Sama_2599 -87 4.2 CTGCTTGATGAGGATCACAATT
Sama_1499 Spea_1673 -278 3.9 CTATGTTAGCTGTGTCGCAAAT
Sama_1569 hmgA -78 4.5 AATTGATACCCAGATCACATAT
Sama_1067 SO3553 -82 4.1 AAATTTGCCAAAGCTCACACAT
Sama_1838 null -324 3.8 TTAATCGATATGGGTCACAGAA
Sama_1870 fadE2 -64 4.3 ACTTGTGATCAGGATCGCTTAT
Sama_1067 SO3553 -82 4.1 AAATTTGCCAAAGCTCACACAT
Sama_2679 cydD -137 4.2 TTTTTTGATCCAGCGCAAATTC
Sama_2901 null -285 4.1 AAAAGAGACTTAGATCATATTT
Sama_0546 SO3895 -214 4.8 AAGTGTGATCACTATCACATCA
Sama_0900 SO3421 -234 4.2 AGTCGTGAGTAAAATCACGTTT
Sama_1067 SO3553 -82 4.1 AAATTTGCCAAAGCTCACACAT
Sama_2949 serA -144 4.2 TTATGTGATATTGTTCTGGTTT
Sama_0861 cyaC -102 4.2 TGAATTGATTCAGATCACGTTA
Sama_0549 Sputcn32_0777 -139 4.3 AAAGTTGATTCACATCAAATTA
Sama_0142 SO0141 -137 4.6 TTTTGTGATGTGGATTAGAAAT
Sama_1688 fumB -144 4.2 ACTTGTGATGTAGCCCAAAGAT
Sama_3143 Spea_3717 -38 4.5 AAACTTGAGCCGCTTCACAAAT
Sama_3096 null -197 4 TAATGGTATTAATATCAAATAT
Sama_3096 null -40 3.7 AGTCGTTATACTGGCCACAAAA
Sama_2539 nqrA-2 -127 4.3 CAGCGTGATTGCGATCGCATTT
Sama_2753 nhaD -112 3.9 AATTTTTACGTGATTCAGATAA
Sama_2754 SO0934 -87 4.7 TTTTGTGGTGTATTTCGCATTT
Sama_1594 ycbW -2 3.9 TTATGTTATTAATGCCACATAC
Sama_2198 null -151 4.4 AATAGTGATTAAGCTCGCGTTT
Sama_2679 cydD -118 4.2 TTCTGTGAATCCCCTAACAAAT
Sama_2422 SO1539 -183 4.7 TTATGTGATTTATGTCTCGATT
Sama_0899 yfiA-2 -78 4.3 AAACGTGATTTTACTCACGACT
Sama_0647 narQ -112 4 GGATGTGTTATTGTTCACACTT
Sama_2223 null -304 4.5 TTTTGTTAACTGCCTCACGTTT
Sama_2091 SO2753 -226 4.7 TTGTGTGATCTTGCGCACGTTA
Sama_1125 null -126 4.5 TTCCTTGATCCAGATCACACAT
Sama_1679 hyaA -172 3.4 AAGCATGACACACCTCATGTTA
Sama_1837 gloA -96 4.3 AACTGTGAGTTGCTTCAGATTT
Sama_2750 SO0939 -297 3.9 AATTGTGATATTGAACAATATG
Sama_3524 moaA -180 4 CTGAGTGAGCGGCGTCACAATT
Sama_3483 SO4606 -318 4.4 TAAAGTGATCTTGATCAATATT
Sama_3003 sel1 -319 3.8 AACCATGATGCAGATCGAAATT
Sama_1214 feoA -228 3.8 AAGTGTGATGAGTGTCACGCCG
Sama_3254 hemC -89 5.1 ATTTGCGATAGAGATCACATTT
Sama_2222 phhA -76 4.6 AAACGTGAGGCAGTTAACAAAA
Sama_1307 null -51 4.3 TTTTGTGAGCTGCATCACGGCA
Sama_3618 null -113 4 TTTGATGATCCACTTCAAACTT
Sama_0545 Shewana3_0734 -112 5.1 TGATGTGATAGTGATCACACTT
Sama_0245 ccmA -207 3.8 TTTTGTGAGTTCCCTCCCAGCT
Sama_2095 SO2757 -210 3.9 AATTTGGAGGAATATCACACAA
Sama_0671 argR -262 4 ATTTGTGAGGTAGATCCTCAAA
Sama_2219 fahA -111 5 AATTGTGATTTGAGTCACGCTA
Sama_0395 purH -194 4 TATTGTGAAATCACGCAGAAAA
Sama_1919 ydhD -173 4.2 ATCTGTGATGTGAATCATTCTT
Sama_0550 SO3890 -128 4.7 TAATTTGATGTGAATCAACTTT
Sama_3619 SO4503 -186 3.9 AAGTTTGAAGTGGATCATCAAA
Sama_3031 null -165 3.9 TAGAGTGATCCTCTGCAAAGAA
Sama_3031 null -104 4.8 AATTATGATGCAATTCAAATAA
Sama_0381 yniC -255 4 AAGTATGAATCAGCTCACACTC
Sama_0589 Sfri_4035 -108 3.8 TTTGTTGATCTGGATCATTAAT
Sama_1791 ccoN -180 4.3 TTTTTTGACACAGCTCAAGTAT
Sama_1920 sodB -91 4.2 AAGAATGATTCACATCACAGAT
Sama_2168 fadI -112 3.6 AAGTTAGAATCGGGTCACACTT
Sama_1213 mtrD -189 3.9 CGGCGTGACACTCATCACACTT
Sama_3004 crp -96 3.8 AATTTCGATCTGCATCATGGTT
Sama_1423 sdhC -80 3.7 TTTTGTGACGACTGTCGCCGTG
Sama_0092 engB -96 4.1 ATATGTGATCGGGGCAATATTT
Sama_1208 mtrC -230 3.9 TTTTTTGATCTGAAACAGCTTT
Sama_1208 mtrC -178 3.6 TAGCCGGATCCAGTTCACACAT
Sama_0602 SO3987 -307 4.1 AAATTGAATATGGATCACATTT
Sama_1614 rplY -233 3.9 AAATGTGAACAAGATCACAGGC
Sama_3282 ilvC -88 4.4 TATAGTGAGTTCAATCACAATC
Sama_3222 frdC1 -144 4.1 GTTTGTGATCCGCTTCCAATAA
Sama_0928 pilV -138 3.9 TATTGTTACTGGCAGCAAACAA
Sama_1934 fadD1 -140 4.8 TTATGTGATGATTGTCAAAAAT
Sama_1570 hmgR -135 4.7 ATATGTGATCTGGGTATCAATT
Sama_0165 pckA -145 4.1 TTTTCAGATCCGGCTCACACAT
Sama_3604 SO4520 -171 3.9 AAATATGCGCTGCTTAACAAAA
Sama_0412 udp -92 4.7 ATTCGTGATCCAGTTAACCTTA
Sama_0974 deoA -135 3.9 ATTTGTGATCCGCGTCGAAACG
Sama_2854 null -78 4 AAACTTGATCTGGATCACGAGT
Sama_3332 SO0318 -282 4.4 TAATTTGAAGTGAATCATAAAA
Sama_2169 SO3090 -137 4.2 AAGTGTGACCCGATTCTAACTT
Sama_2753 nhaD -107 4.1 TTACGTGATTCAGATAAAGCTT
Sama_3253 cyaA -90 5.4 AAATGTGATCTCTATCGCAAAT
Sama_2899 Sama_2899 -126 4.2 AACTGTGATCTGAACCGCAGAA
Sama_1371 ompW -56 4 AATTGTTACGGACGTAACAGAA
Sama_2177 putP -77 3.8 AATTGGGATCCGACCCAAACTT
Sama_2423 icd -89 4.5 AATCGAGACATAAATCACATAA
Sama_2066 SO2637 -139 4 ATTTGTGATCACTGTGGCAATT
Sama_3040 bfd -99 4.1 AAGTGAGAAATAGCTCACCTAT
Sama_1068 SO3551 -192 4.2 ATGTGTGAGCTTTGGCAAATTT
Sama_0996 SO1247 -108 3.8 TCATGTGAGCCAGGTTAAAAAA
Shewanella loihica PV-4
Shew_3389 SO4131 -217 3.9 AAATGTGACACAGGCAACAAAC
Shew_0333 fdrC -98 4.4 TGTTTTGATCTATCTCACGGTT
Shew_1811 ycbW -94 4.6 TGTTGTAATCTATATCATATTT
Shew_1724 cctA -224 4.6 TAGTGTGACGCAGATCATGTTT
Shew_1724 cctA -174 4.7 ATATTTGATTAAGTGCACATTT
Shew_0428 SO0543 -190 4.2 TAGTGTTAACTCGATCAAACAA
Shew_0866 argR -282 4.6 TTATGTGATATAGATCTAGATT
Shew_3394 Sputcn32_0539 -144 4.1 TTGCTTGATATGCTTCACGCTA
Shew_0678 hemG -126 4.1 ATTTGTGACATCGGTAAACTTA
Shew_3424 acnB -140 4.3 GAGTGTGATCTGATTCATACTT
Shew_0191 scyA -131 4.8 AATTCTGATATTAATCACAAAA
Shew_0191 scyA -242 3.8 CAATTTGATATGCTTCCAAAAA
Shew_0200 ppc -107 4.3 CAAGGTGATATAGAACACATAA
Shew_3758 hutC -138 4.1 TTATGTGAGCTAGCTTGTATTT
Shew_1835 ydhD -164 4.2 AGTTGTGATGTGAATCATTGTT
Shew_1667 atoB -75 4.2 TTATTTGAACATGATCACGCTT
Shew_0867 mdh -47 4.5 AATCTAGATCTATATCACATAA
Shew_1438 fahA -130 4.4 GAGTGTGATTTGTATCACGCTA
Shew_1972 SO1419 -120 4.5 TTTTGTTAAGCAGATCAAAATA
Shew_0844 nrfA -156 4.5 AAATGTGACCAACAACACATTC
Shew_0844 nrfA -133 4.2 CATTATGATCTGCCTCAAGTTT
Shew_2677 fixA -234 4.2 AAATGTGAAGCGTGTAACATCA
Shew_3393 SO4138 -109 3.9 TAGCGTGAAGCATATCAAGCAA
Shew_0333 fdrC2 -98 4.4 TGTTTTGATCTATCTCACGGTT
Shew_2518 feoA -245 5.2 ATATGTGATCTAGATCACGTTG
Shew_2153 hmgR -115 5.1 TTATGTGATCTAAGTAACAATT
Shew_1497 Sfri_2271 -123 4.3 TAACTTGAACTGGCTCACGTAA
Shew_3205 napD -154 3.8 AACTTTGATCTCGATCTACAAA
Shew_2074 null -308 5.1 TTTTGTGATAATGGTCACACTT
Shew_3120 Sfri_4035 -108 4.2 TTTGTTGATCTTAATCAAAAAA
Shew_0073 SO4520 -182 4.1 AAACATGACATGCTTAACAATT
Shew_3103 SO3683 -201 4.2 CCACTTGATCCAGATCACATTT
Shew_0757 cadC -115 4.3 TTATGTGCTGATTGTCACGAAA
Shew_3394 kefA -144 4.1 TTGCTTGATATGCTTCACGCTA
Shew_1563 icd -237 3.8 ATTTATGATGTCGGCCAACTAA
Shew_1563 icd -217 4.1 AAATGTGATCGATAGCAAAACG
Shew_0454 SO0572 -124 4.3 TATTTTGACGCCAGTCAAAAAA
Shew_2881 nqrA-2 -131 4.3 CAGCGTGATTGCGATCGCATTT
Shew_0086 etfD -148 4.5 TAATGTGACACCGCTCACGAAG
Shew_0818 SO3797 -26 3.7 ATCTGTGATCTGATTCGAGACT
Shew_0615 SO3774 -146 3.9 AAGAGTGTCCCTCGTCACATTT
Shew_2238 null -48 4.1 AAAATTGATCTAGATCAATAAA
Shew_1092 SO3541 -210 4.4 AACTGTGATCTGTATCACATGG
Shew_0699 nhaD -77 4.2 AAACTTGAGGCGCATCAAAATT
Shew_2760 icd -150 4.4 AAACGTGAGATTGCTCACTATT
Shew_0041 SO0141 -55 4 TTTCGTGACCTAGATTAGACTT
Shew_0331 prmA -274 3.8 AAGCGTGAGACACCTCACCCTG
Shew_0331 prmA -242 4.1 ACATTTGACGTCGATCACAAAC
Shew_1840 SO2871 -51 3.8 CCCTGTGACTCGGCTCACCTTT
Shew_1302 cydA -206 4.7 TTTTGTGAGCCGCCTCTCAAAA
Shew_0570 petA -101 3.9 TAATGAGCCCCGCCTCAAATTT
Shew_0570 petA -130 4.1 TACTATGATCTGCTTCTAATTT
Shew_0087 moaA -189 4.4 CTTCGTGAGCGGTGTCACATTA
Shew_0125 SO4606 -321 4.4 AAAAGTGATCTTGATCAATATT
Shew_0125 SO4606 -264 4 TTATTTGTTATATCGCACAATT
Shew_0586 sel1 -279 3.8 ATTAGTAATATATGTCAACTAA
Shew_0699 nhaD -227 3.8 AAGCGTGATCCTGTGCTAACTT
Shew_0739 SO0919 -188 3.9 AAGTTAGATTCGGCTCACAAAG
Shew_3181 shew_3181 -207 4.3 TTTTGTGAAGCACAGCAAAGAT
Shew_0318 hemC -119 4.7 ATTTGAGAGCTGGATCACACTT
Shew_3776 SO0075 -110 4.7 TTTTGTGCTCCAATTAACATTA
Shew_1033 SO1326 -127 4 TACAGTGAATTATTTAACAAAT
Shew_1033 SO1326 -148 4.4 AAAAGTGATTTTTATTGCATAT
Shew_2881 nqrA-2 -73 4.1 ATGTTTGAAATCTATCTCATTT
Shew_2519 mtrD -170 5.3 CAACGTGATCTAGATCACATAT
Shew_2519 mtrD -260 4.5 TTATGTGACAGATATCTCAATC
Shew_3260 omp35 -150 4.1 AAATTTGATCTGCGCCACACTC
Shew_1765 hyaA -164 3.8 AAACTTGATCCAGCTCATAGCT
Shew_1765 hyaA -103 3.7 AATGTTGACATACATCAACATT
Shew_3252 Shewana3_0734 -163 4.2 ATTTGCGACACGGATCACACCT
Shew_3252 Shewana3_0734 -193 3.8 CAACATGATAAAACTCACGTAA
Shew_3658 null -101 3.6 TATTGCCAAGCGGATCGCAAAT
Shew_2154 hmgA -61 5.1 AATTGTTACTTAGATCACATAA
Shew_1069 hcp -125 4.5 TAATTTGATCCGCTTCATAGTT
Shew_0578 astC -140 3.8 AACTGGTATTTTGATCACGTTT
Shew_0585 crp -238 4 AGATGTGATATGGGCAACATTG
Shew_3251 SO3895 -226 4.6 AGGTGTGATCCGTGTCGCAAAT
Shew_3251 SO3895 -196 3.8 TTACGTGAGTTTTATCATGTTG
Shew_1904 fumB -111 3.9 AAATGTGATGTTCCCCTAAAAG
Shew_1904 fumB -73 4.8 TATTGTGAACGGATTCAAAAAA
Shew_1522 SO2753 -276 3.5 ATTTGCGCTTGATTACGCAAAA
Shew_1515 SO2757 -230 4 ATTTGGGATCATTGTCACTTTT
Shew_2107 SO2535 -191 4.6 TTATATGACCATAATCACAATT
Shew_0190 ccmA -223 4.8 TTTTGTGATTAATATCAGAATT
Shew_0053 SO4503 -190 4 TAGTTTGAACTGGATCATCAAA
Shew_3716 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Shew_0288 ilvC -77 3.8 ATAGTTGATCTCATTCACAGCT
Shew_0288 ilvC -126 3.7 CAATGTGACGTTTCGAATATAT
Shew_3412 purH -182 4 TATTGTGAAATCGCACAGAAAA
Shew_0259 ygbA -96 4.1 TTTTGTGCGCATCTTCATAATT
Shew_1834 sodB -89 3.8 AACAATGATTCACATCACAACT
Shew_0759 SO0939 -246 4.1 TAGAGTGATCAGCTTCACATCG
Shew_2426 fadI -134 3.9 AAGTTAGAATCAGATCACACTT
Shew_3425 yniC -295 4.1 AAGTATGAATCAGATCACACTC
Shew_0560 null -99 4.1 AACTATGACATTGTTCAAAAAA
Shew_2389 Spea_1673 -301 4 AGATGTTAACTAGCTCCCAAAT
Shew_1074 SO3421 -208 4.9 AAACGTGATCTAGATCAACTTT
Shew_3540 cymA -169 4.2 TATTATGAGCAATTTCATAAAA
Shew_0272 SO1410 -151 3.9 ATTCGCGAGCCAAGTCACGAAT
Shew_0272 SO1410 -110 4.6 TGGCGTGATCCATTTCACCTTT
Shew_3657 prlC -247 3.8 ATTTGCGATCCGCTTGGCAATA
Shew_3086 Sama_2599 -117 3.7 AAGCGTTAGCCCACTCACAAAG
Shew_3716 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Shew_2941 lipB -70 5.3 AAATGTGATCTACCTTACATTT
Shew_0319 cyaA -88 5.1 AAGTGTGATCCAGCTCTCAAAT
Shew_2759 SO1539 -171 4.4 AATAGTGAGCAATCTCACGTTT
Shew_3715 engB -95 4.7 TTATGTGATCGGGGTAATATTT
Shew_1036 cyaC -162 4.6 TCATTTGACTTAGATCACAAAT
Shew_2427 SO3090 -296 4.6 AAGTGTGATCTGATTCTAACTT
Shew_0778 SO3987 -82 4.4 TAAAGTGACCTGTCTCACACCT
Shew_0778 SO3987 -147 5.1 AGATTTGATGTAAATCACATTT
Shew_0455 Sama_3134 -94 4.9 CAATGTGATCTGCTTCACACTC
Shew_3390 udp -92 4.6 AAGTGTGATCAGGTTAACCTTA
Shew_1091 phk -238 4.6 CCATGTGATACAGATCACAGTT
Shew_1091 phk -97 4 AAATAAGATATTGAACACATTT
Shew_1985 ccoN -178 4.5 TTTTTTGATATTGCTCAAGTAT
Shew_1435 phhA -40 4.7 AAGTGTGATCCTGTTAACAAAC
Shew_2188 fadD1 -149 4.9 TTGTGTGATGATGTTCAAAATT
Shew_2518 feoA -155 4.2 GATTGAGATATCTGTCACATAA
Shew_0760 cadC -234 3.9 CGATGTGAAGCTGATCACTCTA
Shew_0516 SO4142 -113 4.1 GAAGGTGATCAACATCAAATTT
Shew_0613 cydD -129 4.5 TTTTTTGATCTAGCTCAATTTT
Shew_0613 cydD -110 4.8 TTTTGTGAGCCTAATAACAATT
Shew_0671 swp_4060 -217 4 AATAGTGATGAGGTTAATATAG
Shew_3135 lldP -166 4.2 CATAATGATCTAGATCATATTT
Shew_3135 lldP -247 4.2 ACCAGTGATAGAGATCACACTT
Shew_3623 pckA -128 4.6 TTTCGCGATCTTCCTCACACAT
Shew_2108 fadE2 -71 4.9 AATTGTGATTATGGTCATATAA
Shew_3102 null -84 4.2 AAATGTGATCTGGATCAAGTGG
Shew_1590 SO2589 -85 4.3 AAACGTGATTTTTATCACACCC
Shew_1073 yfiA-2 -76 4.6 AAAGTTGATCTAGATCACGTTT
Shew_1516 Swoo_2741 -105 4.1 AAAAGTGACAATGATCCCAAAT
Shew_0843 narQ -113 4.4 GAATGTGTTGTTGGTCACATTT
Shew_2525 mtrC -179 3.6 TAGAAAGATCTCGGTCACACAT
Shew_3155 null -286 3.9 AAAATAGATCTTGATCATATTT
Shew_1222 Shew_1222 -66 5 TAGTGTGATGCAGCTCTCAATA
Shew_0843 narQ -136 3.9 AAACTTGAGGCAGATCATAATG
Shew_3153 Sama_2899 -137 4.2 AACTGTGATGTGATCCGCAGAA
Shew_0506 SO4154 -30 3.9 TATTGAAATCATTTTCAAAAAA
Shew_0506 SO4154 -9 4 ATTTTTGATATGTATCATCTCA
Shew_1971 apbE -99 4.9 TATTTTGATCTGCTTAACAAAA
Shew_1556 SO2637 -132 4.2 AATTGTGATCGGCGTGGCAATT
Shew_2816 tsx -99 4 TATTGTGATTTAATACAATTTG
Shew_0054 null -127 4.1 TTTGATGATCCAGTTCAAACTA
Shew_0277 SO1415 -137 4.4 TTGTTTGACGTAATTCACAAAG
Shew_0904 SO3588 -97 4.4 TATTGTGATGCCCTTAAGACTT
Shew_1035 SO1328 -110 3.8 TTTTGGGCAGCGCTTCACACTT
Shew_3003 fadE -49 4.9 TTTTGTGACGTAATGCACACTA
Shew_2814 deoA -133 4 AAGTGTGATCTAAATCTATTTG
Shew_0276 SO1414 -216 4.2 CTTTGTGAATTACGTCAAACAA
Shewanella pealeana ATCC 700345
Spea_0140 pckA -112 4.9 TTTTTTGATCTAGTACACATAT
Spea_3824 SO4232 -164 3.8 AAGTGTGATCTACTCTGTATTT
Spea_3733 SO0543 -197 4.2 TTTTGCTACATAGATCGCATAT
Spea_0457 Sputcn32_0539 -138 4.1 AAGCTTGATCCTCTTCACGCTA
Spea_0673 hemG -140 4 TTTTGTGAGGTAGGTAAAGCTA
Spea_0673 hemG -98 3.8 CCTCGTGATCTGTTTCATGTAA
Spea_0425 acnB -268 4 TTATATAATTTAGATCAAGTTT
Spea_0425 acnB -160 4.8 AAGTGTGATCGGATTCATACTT
Spea_1465 SO3120 -158 4 AAACGCGATATAAATCACTTTC
Spea_3971 menD -149 4 TTTTGCTACCCTTATCACATAC
Spea_0019 pepQ -252 4.1 CAGTGTGCGACGAATCACAAAA
Spea_4170 hutC -106 3.8 ATTTGTGAGCTAGCTTGTGTTT
Spea_2783 atoB -138 4.5 AATATTGAGCAAGATCACATTT
Spea_1964 ydhD -154 3.6 ACTTGTGAAGTGTATCATTGTT
Spea_2091 SO1419 -120 4.2 TAGTGTTAACTGTGTCAAATAA
Spea_0831 nrfA -183 4 ATACTTGATTACATTAACAAAT
Spea_0831 nrfA -155 3.8 AAGTGTGAGCAACAACACGTTC
Spea_0831 nrfA -71 4.1 ATAAGTGATTAAATTCAACCTT
Spea_0282 SO0321 -146 4.7 ATACGTGATATTTTTCACTTTA
Spea_4039 fixA -267 5.2 TTGTGTGATCTGTATAACATTA
Spea_2608 putP -104 3.8 TGGTTAGATCTTCATCACATTC
Spea_0392 frdC1 -106 4 AAGGGTGAGTTCCTTCACGAAA
Spea_0325 SO1414 -181 4.1 CAGATTGATTCCTTTCACATTT
Spea_0325 SO1414 -78 4.4 TGGCGTGACTTAGTTCACCTTT
Spea_2491 null -172 4.9 ATATTTGAAGTGTTTCACATAA
Spea_4030 swp_4930 -80 3.8 TATTGTGGCCATAGTTACATTT
Spea_0741 null -161 4.3 TATCGATATCTGCCTCACATAT
Spea_0459 SO4134 -99 4.9 CTATTTGATCGATATCACATTT
Spea_1875 hmgR -114 4.3 TAATGTGATCTAGGTTCAATTT
Spea_4126 SO4520 -164 4.4 AAGTATGATCCGCTTAACAAAA
Spea_3509 crp -225 3.6 AGATGTGATATAAGCCTAATTG
Spea_0624 napD -173 4.3 ATTTGTGAACTAGATCAACACT
Spea_0712 Sfri_4035 -106 4.4 ATTATTGATCTTTATCAAAAAA
Spea_0018 fadB -134 4.6 TTTTGTGATTCGTCGCACACTG
Spea_1784 sdhC -86 4.4 AACCGTGATCTGGATCACTGAT
Spea_2691 feoA -158 4.2 AGTTGAGAGTTTTGTCACATAA
Spea_0430 SO0439 -137 4.8 TTTTGTGATCTAAGTAGCAAAA
Spea_1014 SO1326 -201 4 TAAAGTGATTTTTTTTGCAGAT
Spea_0392 frdC1 -138 4.7 ATTTGTGATCTTGATCTAATAG
Spea_1014 SO1326 -303 3.9 TAAATTGACCTGTATAACCTTA
Spea_2535 icd -195 4.2 AAGTGTGATCTGCAGCTAACTA
Spea_2691 feoA -247 5.5 TTATGTGATGCGTATCACACTT
Spea_2600 SO3090 -306 4.6 AAGTGTGATCTGATTCTAACTT
Spea_2787 ompW -159 4.4 TATTGTGATCTAGATCCTTTTA
Spea_1673 Spea_1673 -311 4.2 AGTTGTTAACTGGATCTCAAAT
Spea_3636 modE -102 4 AAATGTGACTCAACCCAAGATA
Spea_3636 modE -143 4.4 AAACATGATCCAGTTCACAACA
Spea_0591 SO3895 -259 4.3 ATGTGTGACGCTTGTCACGGTT
Spea_0457 kefA -138 4.1 AAGCTTGATCCTCTTCACGCTA
Spea_3709 SO0572 -110 3.7 AAAAATGACCAATGTCATAATT
Spea_2293 swp_4302 -183 4.4 AAGCGTGATTGACCACACAAAA
Spea_4121 etfD -181 4.1 TTTTGTGACAGTTATCACGGCA
Spea_1077 SO3541 -207 4.1 AACTGTGATCTATATCGCTCAG
Spea_3490 SO3774 -127 3.9 ATTATTGCCACTCATCACATTT
Spea_1806 null -155 4.5 TAATTTGATGGAGCGCACGTTT
Spea_0871 purT -176 4.4 AAGAGTGATCTCGCCCACACTT
Spea_0100 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Spea_3968 null -127 3.4 TTTTATGATGAATAAAACGTTC
Spea_0830 narQ -109 4 GAACGTGTTGTTGCTCACACTT
Spea_3260 Shew_1222 -121 4.4 AAAGGTGAGCTCGATCACAAAC
Spea_1009 Sbal_1323 -135 3.7 AAGCTTGATCGTTATAACCCTA
Spea_1970 SO2871 -64 4.8 CATTGTGACTATGATCACAAAA
Spea_0830 narQ -81 3.8 ATTTGTTAATGTAATCAAGTAT
Spea_1466 null -148 4.1 GAAAGTGATTTATATCGCGTTT
Spea_4120 moaA -222 4.1 TGCCGTGATAACTGTCACAAAA
Spea_0737 asnC -7 3.8 ATTTATTATGGAAGTCCCATTT
Spea_0771 SO0919 -161 4.2 TTAAGAGATCTAGCTCTCAATT
Spea_1944 ycbW -62 4.1 TATTTTGATATTGATGAAATTA
Spea_0373 hemC -133 5 AAATGCGATCAAGATCACACTT
Spea_2033 hyaA -211 4.6 TTACGTGACCACGATCACCTTT
Spea_4186 SO0075 -109 4.3 TTTTGTGTGTTAGTTAACAAAA
Spea_0589 omp35 -150 4.4 AAACATGATCTAGTCCACAATT
Spea_3774 SO4118 -196 3.8 TATAGCGATAAAGTTAAAAAAT
Spea_0393 fdrC -94 4.1 TTTGTTGATCTATCTCACGGTT
Spea_0661 swp_4060 -283 4.1 TTATGTGCCATGCAACACATTG
Spea_1874 hmgA -63 4 AAATTGAACCTAGATCACATTA
Spea_1055 hcp -125 4.5 AAAAGTGATCTCTTTCATAGTT
Spea_3516 astC -138 4.1 AACTGGTATTTTGATCACATTT
Spea_4065 prlC -143 3.9 AAACTTGATTAAGATCGCGGAT
Spea_1318 cydA -235 4 ATTCGGGATGGGTGTCACAAAG
Spea_3155 lipB -76 5.2 AAATGTGATCCGTATTACATTT
Spea_1591 Sfri_2271 -100 4.8 ATATTTGATCCAGCTCAAACTT
Spea_2979 SO1539 -113 4.3 AAGAGTGAGCGATCTCACGTTT
Spea_1483 SO2806 -84 4.4 AATTGTGAATAACGTCACACAG
Spea_2569 SO2753 -251 3.9 TAGTGTGGGTTTAGTCACACTT
Spea_2038 fumB -162 4.3 AAATGTGATGTTTAACTCAAAC
Spea_0215 ccmA -112 3.8 ATATTCGAACTACATCAAATTG
Spea_0215 ccmA -212 4.1 TTTTGTGATATTAATCTCGCCA
Spea_4144 SO4502 -20 3.9 TTGCGTGACAAGGATAAAAAAT
Spea_4143 SO4503 -87 3.9 AAGTGTGATCGACCACTAACTT
Spea_4143 SO4503 -183 4.2 TAGTTTGAACTAGATCAACTAT
Spea_2692 mtrD -286 4.1 TTATGTGACAAAACTCTCAACT
Spea_2692 mtrD -197 5.4 AAGTGTGATACGCATCACATAA
Spea_0432 purH -181 4.1 TATTGTGAAATCGCGCAGAAAA
Spea_0303 ygbA -96 3.9 TTTTGTGCACATCTTCAAAGTT
Spea_1505 null -51 4.1 AAAATTGATCTAGATCAATAAA
Spea_0393 fdrC2 -94 4.1 TTTGTTGATCTATCTCACGGTT
Spea_2392 SO2535 -196 4.4 TTTTGAGTTCTATCTCACAATT
Spea_3437 SO0939 -327 4 AAATGAGACGTTAGTCACACTC
Spea_3437 SO0939 -249 4.5 TAATGTGACATCGTTCATGAAA
Spea_0479 mccA -341 4.2 TTTTGTGACCTCTCTATCCTTT
Spea_0503 mccA -286 3.9 TTTTGCGATTTAAAAAACGTAA
Spea_0503 mccA -264 3.9 AGTTGTGATTTTTATATCTAAA
Spea_0424 yniC -286 4.3 AAGTATGAATCCGATCACACTT
Spea_0424 yniC -178 4.1 AAACTTGATCTAAATTATATAA
Spea_3546 null -105 4.3 AAGTTTGACTGCGTTCAAATAA
Spea_1223 SO3406 -248 3.8 TATTTTGATGTTTACCTCGCAT
Spea_3648 scrA -143 4.2 AAGTGTGGTGATAATCACGTTA
Spea_1061 SO3421 -255 4.9 AGTCGTGATCTAAATCACGTTT
Spea_3089 Spea_3089 -256 4.3 TTTTGCGATTCAGATCACTTTG
Spea_0321 SO1410 -157 4.1 ATTCGCGACCGAGCTCACGAAT
Spea_0321 SO1410 -116 4.1 CTGCGTGATCCATTTCAACTTT
Spea_0662 cobA -148 4.1 CAATGTGTTGCATGGCACATAA
Spea_0421 lpdA -128 4.5 GATTGTGATCAGCATCAAACAA
Spea_0100 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Spea_0458 SO4138 -96 3.8 TAGCGTGAAGAGGATCAAGCTT
Spea_3717 Spea_3717 -117 4.7 TTAGGTGATCTGCTTCACAAAC
Spea_3039 psrA -182 4.4 AACTGTGAATTGCCTCACAAAC
Spea_3536 petA -78 4.2 AACTATGATCTGGTTCTAATTT
Spea_2475 SO2891 -166 3.8 TTACGTGCTGAATTGCAAAATT
Spea_2475 SO2891 -69 3.8 AATTGTTACGCATCTTACGCTA
Spea_0374 cyaA -87 5.3 AAGTGTGATCTTGATCGCATTT
Spea_0101 engB -96 4.7 TTATGTGATCGGGGTAATATTT
Spea_1019 cyaC -100 4.6 TCATTTGACTTAGATCACAAAT
Spea_1451 fahA -158 5.3 AAGTGTGATTTCGTTCACACTA
Spea_3921 Spea_3921 -41 4.4 AACTGTGACAAAGATCACTATT
Spea_3708 Sama_3134 -85 4.7 AAGTGTGACCAGGTTCACGAAT
Spea_0734 SO3987 -147 4.1 CGATATGATTTGGATCACTTTT
Spea_0734 SO3987 -82 4.2 AATAGTGATATACATCACAAGG
Spea_3047 deoA -138 4.8 AAGTGTGATCTAAATCTAATTA
Spea_1069 swp_3747 -77 4.4 CTGTGCGATCTGTGTCACAATT
Spea_3357 SO3683 -113 4.6 GAGTTTGATCTAGCTCACAATT
Spea_2599 fadI -116 3.9 AAGTTAGAATCAGATCACACTT
Spea_1448 phhA -126 4.9 AACTGTGATCGGGTTAACAATT
Spea_2214 ccoN -219 4.1 TACCTTGATCTAGATCAACTTA
Spea_2214 ccoN -176 4.6 TTTTTTGATATAGCTCAAGTAT
Spea_2448 fadD1 -156 5 TTATGTGATGATAATCAAAATT
Spea_3103 nqrA-2 -133 4.4 CAGCGTGATTCTGATCGCATTT
Spea_3494 cydD -166 4.4 TTTTGTGAGTCCGATAGCAAAT
Spea_3494 cydD -185 4.1 TTTATTGATCTAGCTCAATTTT
Spea_3438 cadC -149 3.8 GAGTGTGACTAACGTCTCATTT
Spea_3438 cadC -227 4.2 TTTCATGAACGATGTCACATTA
Spea_2994 lldP -241 4.1 AACCGTGACAGATCTCACAATC
Spea_2994 lldP -276 4 TTAGGTGACACAGGTCACACCA
Spea_1861 rarD -85 3.9 CAAGGTGATTCAAGTCACACTC
Spea_2393 fadE2 -70 4.5 AATTGTGAGATAGAACTCAAAA
Spea_1069 null -77 4.4 CTGTGCGATCTGTGTCACAATT
Spea_2663 nadC -262 4.3 TAAAGTGATCGCGATCACACCG
Spea_2663 nadC -152 4.4 AATAGTGACAAACATCACATCA
Spea_3356 null -102 4.7 AATTGTGAGCTAGATCAAACTC
Spea_2507 SO2589 -84 4.2 AAGCGTGATCTAGCTCACTCAC
Spea_1060 yfiA-2 -76 4.6 AAACGTGATTTAGATCACGACT
Spea_3260 Shew_1222 -217 3.7 TTCAGTGATTTATATCGCCACT
Spea_1076 phk -235 3.9 CTGAGCGATATAGATCACAGTT
Spea_0460 udp -92 4.7 AAGTGTGATCGGCTTAACCTTT
Spea_0391 prmA -251 4.1 CTATTAGATCAAGATCACAAAT
Spea_0325 SO1414 -228 4.3 CTTTGTGAATTACGTCATATAA
Spea_2980 icd -146 4.2 AAACGTGAGATCGCTCACTCTT
Spea_0216 scyA -230 4.4 CAATTTGATGTAGTTCGAATAT
Spea_0216 scyA -130 4 TGGCGAGATTAATATCACAAAA
Spea_4071 Swoo_4104 -261 4.6 ATATGGGAGTTGTATCACATTT
Spea_1009 Sbal_1323 -164 4.1 ATGCGTGAGGTGAGTCACGCTT
Spea_0391 prmA -283 4.3 TTTCGTGAAGGAACTCACCCTT
Spea_2090 apbE -32 4.4 TTATTTGACACAGTTAACACTA
Spea_2542 SO2637 -138 4.3 ATTTGTGATTTGTCTGGCAATT
Spea_0326 SO1415 -138 4.5 TTATATGACGTAATTCACAAAG
Spea_4142 null -123 4.2 ATAGTTGATCTAGTTCAAACTA
Spea_2855 etfB -283 4.1 TATTTGGATAAGGATCAAATAT
Spea_0248 SO0296 -118 4.3 ATAGGTGATCTTTATCATAGTA
Spea_0326 SO1415 -247 4.1 ATTCGTGAGTCAGCTCTCGAAT
Spea_3882 SO0355 -124 4.3 AAGTTTGTCTTAGATCACATTT
Spea_3654 Spea_3654 -101 4.9 ATTTGTGATCTTGATTGCAAAT
Spea_3555 bfd -98 3.9 TTAGGCGATCCGACTAACAATT
Spea_3949 pilZ -129 5.2 AATTGTGATGAAAATCAAATTA
Spea_2930 SO1482 -193 5.2 TTTTGTGATCTTCGTCACCTAT
Spea_2886 map -104 4.2 TAATTTGAAAAAAAGCACAAAT
Spea_1234 fadE -68 3.9 AAATTTGATCTATGCCTCGTTT
Spea_0890 SO3588 -246 3.8 TGGCGTGACGTGTGTCACTCTT
Spea_2906 SO1603 -269 3.9 AAGCAAGATTTAGATCACACTT
Spea_3022 SO1247 -187 4.1 TTTAGTGATGTTTTTTAGATTA
Spea_1016 SO1328 -89 4.8 ATTTTTGATTCAGTTCACAAAC
Shewanella halifaxensis HAW-EB4
Shal_0567 mccA -284 3.8 TTTTGCGATTCAAAAAACGTTA
Shal_2777 feoA -158 4.7 AGTTGAGATATTTATCACATAA
Shal_0616 SO4142 -289 3.8 AAGTGTGATCTAGATCTGTTAC
Shal_3818 SO0543 -235 4.7 TTTTGTTACATGGATCGCATAT
Shal_0532 Sputcn32_0539 -137 4 AAGCATGATCCCCTTCACGCTA
Shal_3525 hemG -139 4 TTTTGTGAGGTAGGTAAAGCTA
Shal_3525 hemG -97 3.8 CCTCGTGATCTGTTTCATGTAA
Shal_2707 SO3719 -235 5.3 AAGTGTGATATCGCTCACAAAA
Shal_0482 acnB -247 3.7 TTATATAATTTAGATCAAGGTT
Shal_0482 acnB -139 5 AAATGTGATCGGATTCATACTT
Shal_1258 yfiA-1 -319 3.9 AAGAGTGATAAAAATCAAGCTA
Shal_1258 yfiA-1 -230 3.8 TATCCTGATGAATGCCACAATT
Shal_1548 SO3120 -207 4 AAACGCGATATAAATCACTTTC
Shal_4095 ppc -106 5 AAAAGTGATATAGAGCACATTA
Shal_0297 menD -177 5 TTTTGTTATACCAATCACATAT
Shal_0017 pepQ -250 4 CAGTGTGCGACTAATCACAAAA
Shal_0072 hutC -106 3.9 ATTTGTGAGCCCGCTTGTATTT
Shal_1783 cdd -81 3.9 AACTGAGATCTTCATCTCATTC
Shal_2878 atoB -138 4.2 AATGTTGAGCAAGATCACACTT
Shal_2335 ydhD -154 3.9 AGTTGTGAAGTGTATCATTGTT
Shal_0903 mdh -46 3.9 AAGATGGATCTGAATCACAAAA
Shal_2064 SO1419 -93 4.1 TTGTGTTAACTGCGTCAAATAA
Shal_0551 mccA -340 4.3 TTTTGTGACCTCTCTAGCCTTT
Shal_0886 nrfA -152 4.2 AAGTGTGAGCAACAACACATTC
Shal_0219 fixA -274 4.8 AAGTGTGACACACATAACATTA
Shal_1109 SO3421 -255 4.9 AGTCGTGATCTAAATCACGTTT
Shal_1117 null -77 3.8 CGGTGCGATCTGTATCACTATT
Shal_2680 putP -74 3.7 ATTTGAGCCTTGGCTCATAAAT
Shal_3966 SO1414 -269 4 AATCGGGATTCACTTCACGCTA
Shal_3083 lldP -300 4.5 TTACGTGACACGGATCACAGAG
Shal_3083 lldP -265 4.5 AACTGTGATCAGTCTCACTAAT
Shal_1245 purE -269 4.4 TTGTGGGATCTAGGTAACATTT
Shal_1780 null -174 4.7 ATATTTGAGTTGATTCACAAAA
Shal_0300 null -100 3.6 ATAATTGATTTGTATCAATGTT
Shal_4178 pckA -112 4.8 TTTTTTGATCTTGCCCACATAT
Shal_3966 SO1414 -228 4.2 CTTTGTGAGTTACGTCATACAA
Shal_0228 swp_4930 -81 4.3 TATTGTGCTCACAGTTACATTT
Shal_0478 lpdA -130 4.6 GATTGTGATCCGTATCAAACAA
Shal_0534 SO4134 -97 4.6 CAATTTGATCGATATCACGTTT
Shal_3630 petA -128 4.6 AACTATGATCTGGCTCAAATTT
Shal_2408 hmgR -114 4.5 TAATGTGATCTAGCTTTAATTT
Shal_0016 fadB -134 4.4 TTTTGTGATTAGTCGCACACTG
Shal_0716 napD -174 4.2 ATCTGTGAATCAGATCACCATG
Shal_3794 SO0572 -110 3.9 TAAAATGATGAGTGTCATAATT
Shal_1923 null -199 4.1 ACTTGTGCTGTTTGTCACAATG
Shal_1923 null -306 5.5 AATTGTGATGCGCGTCACAATT
Shal_4103 scyA -230 4.4 CAATTTGATGTAGTTCGAATAT
Shal_2994 null -181 4.6 TTCCTTGATCTAGATCACACTA
Shal_2777 feoA -279 4.7 AAGTGTGATCTGTGTCAAGTTT
Shal_2493 sdhC -86 4.9 ATCTGTGATCTGGATCACCGAT
Shal_0486 SO0439 -138 4.7 TTTTGTGACATAGGTAACACAA
Shal_2672 SO3090 -319 4.6 AAGTGTGATCTGATTCTAACTT
Shal_1245 purE -269 4.4 TTGTGGGATCTAGGTAACATTT
Shal_3720 modE -102 4.3 AAATGCGACCTAATTCAAGTAA
Shal_2000 swp_4302 -182 4.5 AATCGTGATAAACCACACAAAA
Shal_4104 ccmA -212 3.9 TTTTGTGACATAAACCGTACTA
Shal_0442 SO4232 -114 3.8 TTTTGTGCTGTTTTTTATAAAG
Shal_3917 hemC -133 5.1 AAATGTGATCAACATCACGCTT
Shal_3898 fdrC -94 4.1 TTTGTTGATCTATCTCACGGTT
Shal_3900 prmA -249 3.7 CTATTAGACGTAGATCACAAAC
Shal_3900 prmA -281 3.9 TTTCGTGATCAGTGTCACTACA
Shal_4104 ccmA -112 3.8 ATATTCGAACTACATCAAATTG
Shal_0814 null -36 4.3 AAATGGGATGTAAATAACGTAA
Shal_2887 ompW -161 5.1 AAATGTGATCTTCATCGCCTTT
Shal_2472 null -156 4.5 TAATTTGACTGAGCGCACATTT
Shal_0924 purT -169 4.5 AGTAGTGATCTCGTGCACACAT
Shal_1531 phhA -86 4.7 AACCGTGATCTAGTTAACAAAA
Shal_0481 yniC -178 3.7 AACCTTGATCTAAATTATATAA
Shal_2329 SO2871 -64 5.1 ATTTGTGACTCTGGTCACAAAT
Shal_3336 Shew_1222 -216 4.5 TTAAGTGATTTGTATCGCCATA
Shal_3336 Shew_1222 -119 4.8 AATAGTGAGGTGGGTCACAAAT
Shal_1059 Sbal_1323 -163 4.3 ATCTGTGAACCTTGTCGCATTT
Shal_0885 narQ -111 4.3 GAATGTGTTGTTGCTCACACTT
Shal_1549 null -148 4.1 GAAAGTGATTTATATCGCGTTT
Shal_0122 moaA -222 4.3 TGGCGTGATAACTGTCACAAAA
Shal_0823 SO0919 -160 4.3 TTAAGCGATCTAGCTCTCAATT
Shal_2355 ycbW -62 4.1 TATTTTGATATTGATGAAATAA
Shal_3187 nqrA-2 -127 3.7 CAGCGTGATTACAGTCGCACTT
Shal_0063 SO0075 -109 4.5 TTTTGTGTTTGAGTTAACAAAA
Shal_0676 omp35 -150 4.4 AAACATGATCTAGTCCACAATT
Shal_3859 SO4118 -196 3.8 TATAGCGATAAAGTTAAAAAAT
Shal_2261 hyaA -212 5 TTACGTGATCTCCATCACCTTT
Shal_1764 SO2589 -84 4.4 CAGCGTGATCTACGTCACATTG
Shal_2004 swp_4060 -157 4.3 TAATGTGATTTTCAGAATAATT
Shal_3535 swp_4060 -147 3.9 AAATATGAGCTTGTTCCAAATT
Shal_3240 lipB -76 5.2 AAATGTGATCCGTATTACATTT
Shal_2409 hmgA -63 3.9 AAATTAAAGCTAGATCACATTA
Shal_0192 null -105 4.2 TATTGTAAACCACGTCGCAAAT
Shal_1103 hcp -96 4.3 TAAGGTGATCTCTTTCATGTTT
Shal_3610 astC -138 3.7 AACTGGCATTCTGATCACATTT
Shal_0193 prlC -192 4.4 ATTTGCGACGTGGTTTACAATA
Shal_0193 prlC -142 4.2 AAATTTGATCTAGATCCTAGAT
Shal_1381 cydA -234 4.1 ATTTGGGATGAGTATCACGGAA
Shal_1659 Sfri_2271 -100 4.3 ATGCTTGATCTAGCTCAAACTT
Shal_1686 SO2753 -266 3.6 TATTGCGGGGTTTGTCACGTTT
Shal_1682 SO2757 -225 3.9 ATTTGATATCAATATCACTTTT
Shal_2256 fumB -162 4.3 AAATGTGATGTTTAACTCAAAC
Shal_2887 ompW -111 4.8 ATTTTTGATTCAGGTCAAATTT
Shal_0099 SO4503 -85 4.5 AAATGTGATCTACTACTAATTT
Shal_0099 SO4503 -181 4.2 TAGTTTGAACTAGATCAACTAT
Shal_2778 mtrD -305 4.5 TTATGTGATAAATATCTCAACT
Shal_2778 mtrD -184 4.6 AAACTTGACACAGATCACACTT
Shal_1587 null -80 4 TAGTGTGATTGATATCTATAAT
Shal_0488 purH -182 4.1 TATTGTGAAATCGCGCAGAAAA
Shal_3986 ygbA -96 4 TTTTGTGCACATCTTCAAACTT
Shal_3899 frdA -138 3.9 GTTTGTGATCTACGTCTAATAG
Shal_3899 frdA -106 4.2 TGTAGTGACACTGATCACGAAA
Shal_3898 fdrC2 -94 4.1 TTTGTTGATCTATCTCACGGTT
Shal_2336 sodB -93 3.7 AACAATGATACACTTCACAACT
Shal_1567 SO2806 -84 4.7 AATTGTGAACAACATCACACAG
Shal_1891 SO2535 -199 4.2 TTTTGAGGTTTATCTCACAATT
Shal_3518 SO0939 -328 4.2 AAATGAGAGGTTAATCACACAG
Shal_3518 SO0939 -250 4.7 TAATGTGCTATCGGTCACAGAA
Shal_0481 yniC -286 4.5 AAGTATGAATCCGATCACATTT
Shal_3640 null -165 3.8 TTACGTGATCGAGCGCTAGTTT
Shal_3640 null -104 4.3 AAGTTTGACAGTGTTCAAATAT
Shal_1257 SO3406 -301 4 TAGCTTGATTTTTATCACTCTT
Shal_1257 SO3406 -140 4.2 ATTTGAGAGCTATATCGCAGTT
Shal_3174 Spea_3089 -268 4.5 TTCCGTGATCAATATCACCTTA
Shal_3174 Spea_3089 -40 3.7 ATTTGAGATTCTATTTACAACT
Shal_3970 SO1410 -156 4.1 ATTCGCGACTTGGCTCACGAAT
Shal_3970 SO1410 -115 4.1 CTGCGTGATCCAATTCAACTTT
Shal_0693 Sputcn32_1188 -287 4.4 TATTGTGACAAGACTCAACTTA
Shal_0693 Sputcn32_1188 -110 4 AATTGTGACCACAATCAATTTG
Shal_0881 fkpA -99 4.1 TAATCTGATTGGAATAACCTAT
Shal_3589 cydD -233 4.1 TTTATTGATCTAGCTCAATTTT
Shal_1683 Swoo_2741 -108 4.4 AAAAGTGATATTGATATCAAAT
Shal_4222 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Shal_4222 cytcB -95 4.4 AAATATTACCCCGATCACATAA
Shal_0533 SO4138 -96 3.8 TAGCGTGAAGGGGATCATGCTT
Shal_3802 Spea_3717 -117 4.7 TTAGGTGATCTGCCTCACAAAG
Shal_3127 psrA -183 4.5 AACTGTGAATTGCTTCACAAAC
Shal_0790 asnC -248 3.8 ATTTATAATGATAATCACAACT
Shal_3916 cyaA -88 5.3 AAGCGTGATGTTGATCACATTT
Shal_1534 fahA -144 4.5 CAGTGTGATTTATCTCACGCTA
Shal_3068 SO1539 -114 4.4 AATAGTGAGCAATCTCACGTTT
Shal_4221 engB -96 4.7 TTATGTGATCGGGGTAATATTT
Shal_1062 SO1326 -210 4 TAAAGTGATTTTTCTTGCAGAT
Shal_4287 SO4743 -46 3.8 TATTGCGACTCAATTAATACAT
Shal_0348 Spea_3921 -42 5 AAGTGTGACGCAGATCACCATT
Shal_3793 Sama_3134 -156 4.9 AAGCGTGATCTGGTTCACGAAT
Shal_3135 deoA -138 4.8 AAGTGTGATCTAAATCTAATTA
Shal_1117 swp_3747 -77 3.8 CGGTGCGATCTGTATCACTATT
Shal_1065 cyaC -99 5.1 TTATTTGACTTAGATCACAAAT
Shal_0121 etfD -180 4.2 TTTTGTGACAGTTATCACGCCA
Shal_3603 crp -226 3.5 AGATGTGATACAAGCCTAATTG
Shal_0567 mccA -159 4.1 AAGTGTGCTGTAGCGCAGATTT
Shal_3429 SO3683 -113 4.4 GAATTTGATCTCAGTCACAATT
Shal_0567 mccA -262 3.9 AGTTGTGATTTTTATATCTAAA
Shal_2671 fadI -119 3.9 AAGTTAGAATCAGATCACACTT
Shal_2197 ccoN -221 4.5 AGATTTGATCTAGATCAACTTT
Shal_2197 ccoN -178 4.6 TTTTTTGATATAGCTCAAGTAT
Shal_3519 cadC -227 4.6 TTCTGTGACCGATAGCACATTA
Shal_3519 cadC -149 4.4 CTGTGTGATTAACCTCTCATTT
Shal_1832 fadD1 -155 5 TTATGTGATGATAATCAAAATT
Shal_3589 cydD -214 4.9 TTTTGTGAGTCCGATAACATTT
Shal_2784 mtrC -264 4 TTTTATTACATTTATCACGTAT
Shal_0116 SO4520 -164 4.2 AAGTATGACCCGCTTAACAAAA
Shal_1890 fadE2 -70 4.3 AATTGTGAGATAAACCTCAAAA
Shal_2750 nadC -250 4.5 TAAAGAGATCGAGATCACACTA
Shal_2750 nadC -140 3.8 TTAAGAGATGTTTATCGCAATC
Shal_3428 null -90 4.8 AATTGTGACTGAGATCAAATTC
Shal_0680 Sputcn32_0777 -79 3.9 GTTTTTGACTAAGATCAAAAAA
Shal_4284 yfiA-2 -83 4.6 AAACATGACCTAGATCACACTA
Shal_4284 yfiA-2 -58 3.8 TAATGTGATTGGACTATTGTAA
Shal_1108 yfiA-2 -76 4.6 AAACGTGATTTAGATCACGACT
Shal_1124 phk -56 4.3 TATAGTGAGTTATATAAAATTT
Shal_0535 udp -92 4.6 AAGTGTGATCAGTTTAACCTTT
Shal_2591 Spea_1673 -312 4.2 AGTTGTTAACTGGATCTCAAAT
Shal_0678 SO3895 -253 4.8 GTTTGTGATGTCTATCACGTTT
Shal_1924 gloA -95 4 TAAATTGATCTCGCTCAATTTT
Shal_0849 cadC -117 4.4 TAGTGTGCTAGACCTCACGAAA
Shal_0787 SO3987 -81 4.9 AATAGTGATGCAGATCACACTG
Shal_3069 icd -149 4.4 AAACGTGAGATTGCTCACTATT
Shal_2568 rarD -85 4.2 CAGAGTGATTCAAGTCACACTT
Shal_0189 Swoo_4104 -261 4.8 ATGTGAGATTTGCATCACAATT
Shal_2063 apbE -95 4.4 TTATTTGACGCAGTTAACACAA
Shal_1712 SO2637 -140 4.1 ATTTGTGAACTATCTGGCAATT
Shal_3966 SO1414 -78 4.4 TGGCGTGACTTAGTTCACCTTT
Shal_3965 SO1415 -247 4.2 ATTCGTGAGGCAGCTCTCGAAT
Shal_3965 SO1415 -138 4.3 TTGTATGACGTAACTCACAAAG
Shal_0100 null -124 4.2 ATAGTTGATCTAGTTCAAACTA
Shal_4072 SO0296 -133 4.3 ATAGGTGATCTTTATCATAGTA
Shal_0387 SO0355 -124 4.3 AAGTTTGTCTTAGATCACATTT
Shal_3744 Spea_3654 -101 4.3 AAGTGTGATCTTGGCTACAAAT
Shal_0318 pilZ -195 4.3 ATATTTGCTAGACATCACATTG
Shal_0318 pilZ -141 5 ATTCGTGATGGAAATCAAATTA
Shal_3021 SO1482 -193 5.2 ATTTGTGACGTTGATCACCTAT
Shal_2982 map -92 3.7 TAATATGAAAAAAAGCACAAAC
Shal_1266 fadE -67 4.4 AAGTTTGATCTACAGCTCATTT
Shal_3007 SO1603 -265 4.2 ATGTTTGAGCTAGATCACTCTT
Shal_1245 null -269 4.4 TTGTGGGATCTAGGTAACATTT
Shal_0532 kefA -137 4 AAGCATGATCCCCTTCACGCTA
Shal_1064 SO1328 -89 4.6 ATTTTTGATTCAGTTCACAGTC
Shal_3735 scrA -144 4.2 AAATGTGGCGAAAATCACGTTA
Shewanella piezotolerans WP3
swp_3151 putP -72 3.7 ATTATTGAGCTATAGCTCAAAT
swp_0532 SO0543 -156 4.6 TTTTGTTACACAGATCGCATAT
swp_4101 argR -140 3.8 ATTTATACTCTACATCATATTT
swp_4046 hemG -124 3.9 TTTTGTGAGGTAGGTAAAGGTA
swp_4046 hemG -77 3.7 TGATCTGATTCAATTAAAAATA
swp_4740 acnB -245 3.9 TTATGTGATTAATCTCAGTGTT
swp_4740 acnB -139 4.9 AAGTGTGATCTGATTCATACTT
swp_3409 null -177 4.1 TGATGTGATAAAAAGCACTCAT
swp_1670 SO3120 -185 3.7 AAACGCGATTTAAGTCACTTTC
swp_5150 SO4743 -117 4.3 TGTTGTGCGCGAGTTCACATTG
swp_2044 scyA -131 4.8 TAACGCGATTTAAATCACAAAT
swp_2044 scyA -231 4.4 CAATTTGATGTAGTTCGAATAT
swp_2053 ppc -106 4.4 TAAAGTGAGGTAGAGCACATTC
swp_4791 SO4567 -74 4.3 ATATTTGATTCATCTCATATAC
swp_0132 hutC -177 4.2 ATTTGTGAGCTAGCTTGTATTT
swp_3037 cdd -82 4.1 AAGTGCGATCTCTGTCGCATTC
swp_2753 ydhD -153 3.6 ACTTGTGAAGTGTATCATTGTT
swp_3387 atoB -175 4.4 AATGTTGAGCGAGATCACATTT
swp_4100 mdh -46 3.9 AAAACAGATCTAAATCACAAAA
swp_2516 SO1419 -119 4.5 AAATGTTATCTCTGTCAAACAA
swp_1867 null -21 4.2 AAGTGTGATCCGCAACTAAATT
swp_3958 nrfA -150 4 AAATGTGAGCAACAACACGTTC
swp_4939 fixA -269 4.7 AAGTGTGACGAACATAACATTA
swp_3151 putP -70 4.3 TATTGAGCTATAGCTCAAATAT
swp_0429 fdrC2 -94 3.9 TTTGTTGATCTATCTCACTGTT
swp_0428 frdC1 -106 3.8 TAGGGTGAGCAAAGTCACGATT
swp_3738 phk -96 3.8 AAATAAGATACAGGACACATTT
swp_0035 fadB -127 4.4 TTATGTGATTAGTCGCACACTG
swp_4512 SO3895 -215 3.9 ATGTGTGATATTAATCATAGGT
swp_2955 sdhC -20 4.6 AACTGTGACCTAGTTCACGGAT
swp_4339 Sputcn32_0834 -322 3.9 TAATGCAATTGGTATTACAATA
swp_4703 SO4134 -306 4 TAAGGTTAACCTGATCACACTT
swp_4703 SO4134 -88 4.8 AAACATGATCTAACTCACAAAT
swp_2869 hmgR -115 4.9 TAATGTGATCTTGTTATCAATT
swp_5018 SO4520 -166 4.2 AAGTATGACTTACTTAACAAAA
swp_2362 null -310 4.7 AAGCGTGACCTGTGTCACACTT
swp_3802 SO1326 -111 3.8 TTATTTGAGCTAGCGCTAATAA
swp_4367 Sfri_4035 -104 4.1 AACCTTGATCTTAATCATAATT
swp_3738 phk -237 4.5 CTGAGTGATACAGATCACACAT
swp_1167 nqrA-2 -132 4.3 CAGCGTGATTGCGATCGCATTT
swp_4577 SO4142 -133 4 GAAAGTGATCGAGCTCAACTAT
swp_4239 cadC -248 4.2 TAACGTGCTAAAGCTCACGAAA
swp_3271 feoA -157 4.2 AGTTGAGAGATTTGTCACATAA
swp_4930 swp_4930 -80 4.3 TAATGTGCCCCAAGTTACATTT
swp_0793 petA -131 4.2 AACTATGATCTGGTTCTAATTT
swp_1953 Spea_1673 -311 4 AGTTGTTAAGTCGCTCTCAATT
swp_1653 fahA -140 5 TAGTGTGATTTAGCTCACGCTA
swp_3538 null -271 4.4 TTCCTTGATCGAGATCACACAA
swp_0644 modE -105 4.1 TTCTGCGACTTACTTCAAATAA
swp_1052 SO3683 -113 4 GAAGTTGATCTTGCTCACAAAA
swp_4302 swp_4302 -180 4.3 TTTAGTGATAGAGCACACAGAA
swp_3472 etfB -276 3.7 TATTTCAATAAGGATCAAATAT
swp_0563 SO0572 -110 3.6 TTTATTGACGATAGTCAAAAAA
swp_3395 ompW -214 4 TTGCGTGTTGTATGTCACCAAA
swp_3395 ompW -161 4.4 AAATGTGATCGCGATCACTGCT
swp_0429 fdrC -94 3.9 TTTGTTGATCTATCTCACTGTT
swp_4841 yhgI -131 3.8 AAATGTGATCAGAACTGCGTTA
swp_0809 SO3774 -137 3.9 AAAGGTGTCGCTCGTCACATTT
swp_2923 null -184 4.3 TAGTTTGATGGAGCGCACGTTT
swp_3737 SO3541 -210 4.5 ATGTGTGATCTGTATCACTCAG
swp_4077 purT -147 4.1 CAGCGTGATCTGCCGCACGTTT
swp_3271 feoA -280 4.6 AAGCGTGATCTACGTCACACTG
swp_3606 icd -293 4.6 AAACGTGAGATTGCTCACCTTT
swp_0168 SO0141 -156 4 ATTCGTGACCTAGATTAGACTT
swp_0427 prmA -286 4.5 AATCGTGACTTTGCTCACCCTA
swp_0755 crp -309 4.2 TTTATTGATAAGGTTCAAAAAA
swp_1671 null -220 3.8 GAAAGTGACTTAAATCGCGTTT
swp_5009 moaA -222 4.3 TGAGGTGATTAGTGTCACAAAA
swp_0756 sel1 -153 3.8 TTTTTTGAACCTTATCAATAAA
swp_4263 SO0919 -161 4 ATAAGCGATATAGCTCCCAATA
swp_4059 cobA -119 4.3 TTTTATGATATGCATCACCTCA
swp_2809 ycbW -239 3.8 TTTAATAATATAGATCATAAAA
swp_2809 ycbW -143 4.1 TATTTTGATATTGATGAAATTA
swp_2809 ycbW -2 4 ATATGGAATTTCTATCACCTTT
swp_0402 hemC -40 4.3 AAATGTAATCCGTATCGCAACA
swp_4514 omp35 -150 4.1 AAACTTGATCTAGCCCACAATC
swp_0481 SO4118 -181 3.8 TATAGCGATAAAGTTAAAATTT
swp_4513 Shewana3_0734 -177 3.9 ACCTATGATTAATATCACACAT
swp_4060 swp_4060 -318 4.3 TGAGGTGATGCATATCATAAAA
swp_2870 hmgA -61 4.1 AATTGATAACAAGATCACATTA
swp_2870 hmgA -84 3.5 TTTTTTGCTGTTGTTAGCAACT
swp_4927 null -104 3.7 TATTGCAAAGCGCCTCGCAAAT
swp_3762 hcp -42 4.4 TAAGGTGATCTCTTTCATAGTT
swp_0747 astC -140 4.1 AACTGGTATTTTGATCACATTT
swp_4926 prlC -311 3.7 ATTTGCGAGGCGCTTTGCAATA
swp_4926 prlC -261 3.6 AAAATTGACTTTAGTCAAAGAT
swp_1789 Sfri_2271 -100 4.1 CTCTATGATATAGCTCACAGAT
swp_4512 SO3895 -245 3.8 CGATGTGATCTTGATCTGGTTT
swp_1689 SO2806 27 4.3 AACTGTGAAAGGTATCACACAC
swp_3756 SO3421 -366 4.9 AGTCGTGATCTAAATCACGTTT
swp_1825 SO2753 -248 3.6 TTGTGAGTCCTTAATCACGTTT
swp_2633 fumB -162 4.4 AAATGTGATGTTTAACTCAAAG
swp_1820 SO2757 -77 4.1 ATTTGAGAGCAATATCACTTTT
swp_4749 lpdA -113 4.5 GATTGTGATCAGTATCAAACAA
swp_1469 cydA -231 4.2 AGGTGAGACGGTGATCACAATA
swp_2043 ccmA -112 3.8 ATATTCGAACTACATCAAATTG
swp_5036 SO4503 -25 4 AAAGGTAATTGAAATCTCATAA
swp_5036 SO4503 -86 4.2 AAGTGTGATCTGCAGCTAACTT
swp_3272 mtrD -308 4.2 TTATGTGACAAATCTCTCAACT
swp_3272 mtrD -185 4.6 CAGTGTGACGTAGATCACGCTT
swp_5075 cytcB -95 4.4 AAATATTACCCCGATCACATAA
swp_0358 ilvC -77 4.6 TATAGTGATCTCAATCACAGCT
swp_4724 purH -181 4.1 TATTGTGAAATCGCGCAGAAAA
swp_2171 ygbA -96 4 TTTTGTGCGCACCTTCAAACTT
swp_1711 null -21 4.1 AAAATTGATCTAGATCAATAAA
swp_4657 mccA -246 4.1 TTATGTGCTCTAGCGCATGTTT
swp_4741 yniC -283 4.4 AAGTATGAATCAGATCACACTT
swp_4741 yniC -177 3.7 AACACTGAGATTAATCACATAA
swp_4741 yniC -101 3.7 TTTCGTAAAGCTAAACACAATA
swp_1592 cysC -204 3.9 TTTTGTTATGACGGTTGCATTT
swp_4806 cymA -276 3.8 ATTTGAGATCTAAAAAAAAATA
swp_5075 cytcB -95 4.4 AAATATTACCCCGATCACATAA
swp_1238 psrA -191 4.4 AACTGTGAAACAACTCACAAAG
swp_3020 yceI -42 3.8 TACATTGATATCTATCACTATT
swp_3928 lipB -69 5.2 AAATGTGATCTGTCTTACATTT
swp_0403 cyaA -106 5.5 AAATGTGATCGGAGTCACATTT
swp_3605 SO1539 -144 4.2 AAAGGTGAGCAATCTCACGTTT
swp_5074a engB -96 4.7 TTATGTGATCGGGGTAATATTT
swp_5010 etfD -176 4.4 TTTTGTGACACTAATCACCTCA
swp_3798 cyaC -98 4.6 TCATTTGACTTAGATCACAAAT
swp_3965 fadD-2 -222 3.7 ATGCGCGATTTGCATTACCTTT
swp_0564 Sama_3134 -100 5.7 TTTTGTGATCTGCCTCACAAAT
swp_4346 SO3987 -4 4.6 TACTGTGATCGATATCACGTCT
swp_1230 deoA -139 4.8 AAGTGTGATCTAAATCTAATTA
swp_2572 ccoN -221 4.3 TAGCTTGATCTAGATCAACTTT
swp_2572 ccoN -178 4.4 TTTTTTGACATAGCTCAAGTAT
swp_2289 fadD1 -153 5 ATATGTGATGATAATCAAAATT
swp_1650 phhA -76 5 AACTGTGATCTGGTTAACAAAA
swp_4010 cadC -258 4.3 TTTATTGATCTAGATCTAATAA
swp_0182 pckA -113 4.9 TTTTTTGATCTAGTCCACATAT
swp_2312 fadE2 -97 3.5 AATTGTGACGTAGACCCGCAAA
swp_3141 SO3090 -97 4.6 AAGTGTGATCTGATTCTAACTT
swp_3140 fadI -122 3.9 AAGTTAGAATCAGATCACACTT
swp_3241 nadC -123 3.8 TTATGCGCCCTTCATCACCCTA
swp_1054 null -79 4.3 TTTTGTGAGCAAGATCAACTTC
swp_3059 SO2589 -87 4.2 GAATGTGATCTAGCTCACAGGT
swp_4510 Sputcn32_0777 -64 4.1 AAACGTGATCAACAGCATCTTT
swp_3757 yfiA-2 -76 4.6 AAACGTGATTTAGATCACGACT
swp_1821 Swoo_2741 -108 4.7 AAAAGTGATATTGCTCTCAAAT
swp_1085 Shew_1222 -105 4.5 AAAGGTGAACTAGATCACAAAG
swp_4702 udp -92 4.6 AAGTGTGATCAGGTTAACCTTA
swp_4702 udp -310 4.7 ATTTGTGAGTTAGATCATGTTT
swp_4118 null -97 3.3 TTATATAATGATTTTTATATTT
swp_2043 ccmA -212 5 ATTTGTGATTTAAATCGCGTTA
swp_4120 Sama_2899 -157 4.2 TATTGTGACCGGTTACGCAGTA
swp_3809 Sbal_1323 -141 4.7 TTCTGTGATTCAGGTCGCAAAT
swp_4588 SO4154 -9 4.4 ATATTTGATATGTACCACCTTA
swp_2515 apbE -105 4.4 TTGTTTGACAGAGATAACATTT
swp_1858 SO2637 -143 4.3 ATTTGTGATCCATGTGGCAATT
swp_5035 null -87 3.8 AAGTTAGCTGCAGATCACACTT
swp_5035 null -148 4 TTATGAGATTTCAATTACCTTT
swp_2077 SO0296 -120 4.3 ATGAGTGATCTTGTTCATAGTA
swp_0315 SO0355 -127 3.9 AAAGTTGTCATAGATCACATTT
swp_4772 pilZ -217 4.4 ATTCGTGCTGAAAATCAAATTT
swp_3568 SO1482 -184 4.4 AACTGTGATCTCTATCACCGAC
swp_3524 map -93 4.2 TATTTTGAAAAAAAGCACAAAT
swp_3422 fadE -67 4.4 AAATTTGATCTGCCGCTCAATT
swp_3549 SO1603 -268 4.5 ATATTAGATCTAAATCACACTT
swp_3549 SO1603 -238 3.9 TAACGTTAGTTACCACACAAAA
Shewanella sediminis HAW-EB3
Ssed_1531 feoA -158 4.3 AGTTGAGACTTTTGTCACATAA
Ssed_1531 feoA -275 4.9 AAGTGTGATCTTGGTCACGCTA
Ssed_0240 null -100 4.1 TTGTTTGATTTAAATCAAGGTT
Ssed_3377 deoA -134 4 AAGTGTGATCTAAATCTATTTG
Ssed_0598 SO0543 -213 4.2 TAATGTTAAATCGATCTCACTT
Ssed_0951 argR -254 3.8 ATTTTTGTTCTACATCAATAAA
Ssed_0457 Sputcn32_0539 -154 4.2 ATTCATGATCCACTTCACCTAG
Ssed_3790 hemG -120 4.9 ATTTGTGATGCAGGTAAAATTT
Ssed_3790 hemG -78 4 TGCCGTGATCTGTTTCATGTAA
Ssed_0438 acnB -141 4.4 GAGTGTGATCTGATTCAAACTT
Ssed_1170 SO3421 -236 4.9 AGTCGTGATCTAAATCACGTTT
Ssed_3162 map -91 3.9 TATTGAGAGAGCAAACACAAAT
Ssed_1530 mtrD -174 4.8 TAGCGTGACCAAGATCACACTT
Ssed_4278 ppc -111 3.9 CCGAGTGATGTAGAGCACATAA
Ssed_0226 menD -302 4.4 TAAAGTGATCTACAACTCAAAT
Ssed_0025 SO0023 -48 3.8 TTTTCTGATAGATTTTACATCA
Ssed_4448 hutC -150 4.1 AGTTGTGATCCAACTTGTATTT
Ssed_2618 cdd -82 3.9 AAATGGGAGCTGGATCTCATCA
Ssed_1473 atoB -92 4.3 TTAATTGAGCAAGATCACACTT
Ssed_0952 mdh -136 4.1 TTTATTGATGTAGAACAAAAAT
Ssed_3439 SO3811 -203 4.3 TAACGTGATGAAAGTAAAATTT
Ssed_2279 SO1419 -159 4.2 ATGTGTTAACTGGGTCAAATAT
Ssed_4426 null -123 3.9 ATTGATGATCCAGCTCAAGTTA
Ssed_1883 icd -275 3.9 AAGTGTGATCTGCGCCAAGTTG
Ssed_0931 nrfA -154 4.6 AAGTGTGAGCAACACCACATTT
Ssed_0931 nrfA -131 3.9 CATTTTGATCTACCGCATACTT
Ssed_3230 fixA -306 4.8 AAGTGTGACCCGCCTAACATTA
Ssed_1619 putP -72 3.9 TATTGAGCTTCCTATCAAACAT
Ssed_1826 Sfri_2271 -165 3.8 CAACTTGATTTCGCTCAAGTAT
Ssed_4362 pckA -142 4.1 AAACACGATCTTCCTCACACAT
Ssed_4133 hemC -133 4.9 AAATGAGATCAAGATCACACTT
Ssed_3221 swp_4930 -77 4.4 TATTGTGCGCCTGATTACATAT
Ssed_2709 gloA -312 3.8 TTTTGTAATTTTTTAAACAGTA
Ssed_3379 tsx -245 3.9 CTGTGTGAGGATAAACACAATT
Ssed_0461 udp -92 4.7 AAGTGTGATCGAGCTAACCTTT
Ssed_2504 udp -84 3.9 CAATGTAATATGCAAAACATTT
Ssed_0493 mccA -324 4 TATTGTGACCCACTCAAGATTT
Ssed_2036 null -316 4.6 TTTCGTGACGCGCGTCACAGTT
Ssed_3873 crp -173 3.8 TTAGTTGACTTATATCACTAAT
Ssed_1628 fadI -151 3.9 AAGTTAGAATCAGATCACACTT
Ssed_2855 null -49 4.1 AAAATTGATCTAGATCAATAAA
Ssed_3889 Sfri_4035 -107 4.2 TTTGTTGATCCTTATCAAAAAA
Ssed_1339 SO3411 -101 4 TATTGTGAAATATTTTACTGTT
Ssed_4117 prmA -53 5 TAATGTGATTGGTATTACAATA
Ssed_0918 fkpA -96 3.9 CAATGTAATTGGAATAACGTAT
Ssed_4047 psrA -228 3.9 ACATTAGATAAATATCACATTT
Ssed_4403 etfD -150 4.8 TTTTGTGACACCCCTCACATAC
Ssed_3193 SO0439 -105 4.3 ATTTGTGACCAAGTTCCCAAAC
Ssed_0482 mccA -331 4.3 TTTTGTGACCCCGTTAGCCTTT
Ssed_4184 SO1414 -280 3.8 AATCGGGATTAGCTTCACGCAA
Ssed_4184 SO1414 -239 4.1 CTTTGTGAGTTACCTCATGTAA
Ssed_3956 napD -187 4.1 ATCTGAGACATAGGTCACACAT
Ssed_4115 fdrC -104 4.4 TGTTTTGATCTGCCTCACGGTT
Ssed_0883 cadC -147 4.7 CAGTGTGATTTTGTTCGCAAAA
Ssed_4115 fdrC -74 3.9 ATATGTGAGCGACATTATGATT
Ssed_1334 SO3553 -233 4.1 GTAAGTGCTACGCATCACATTT
Ssed_2438 SO2871 -64 5 TTTTGTGACTTTGCTCACCTTT
Ssed_4287 ccmA -223 4.5 TTTTGTGATTTCAATCAAAGCT
Ssed_1187 SO3541 -214 4.2 AACTGTGATCTGCGTCACATGG
Ssed_1908 hyaA -162 4 AAAGATGATCTAGTTCATATTG
Ssed_0917 SO1064 -148 3.8 ATACGTTATTCCAATTACATTG
Ssed_3846 SO3774 -162 4 AATGGTGTCCCTCGTCACATTT
Ssed_3849 cydD -120 4.7 TTTTGTGAATCCGTTAACAATT
Ssed_1469 ompW -108 3.7 TTAATTGATCTGGATCAATAAG
Ssed_0973 purT -160 4.6 TAAAGTGATCCACTACACACTT
Ssed_3318 icd -151 4.7 AAATGTGAGATTGCTCACTATT
Ssed_0801 petA -132 4.4 TACTATGATCAAGCTCAAATTT
Ssed_4373 SO0141 -198 3.7 ATCATTGATAAATATAACAAAA
Ssed_3118 cydA -203 4 TAGTGTGAAGTTCGTCGTAAAA
Ssed_4427 SO4503 -153 3.9 TAACTTGAGCTGGATCATCAAT
Ssed_4427 SO4503 -59 3.8 TTAAATGAGAGAGATCACGCAT
Ssed_1323 Shew_1222 -145 5.1 AAAGGTGATCGATATCACATAT
Ssed_1121 Sbal_1323 -140 4.3 ATCTGTGATGCAAGTCGCAATC
Ssed_0930 narQ -113 4.8 AAATGTGGTGTTGCTCACACTT
Ssed_2897 null -173 4.7 TAAAGTGATTTAGATCGCGTTT
Ssed_4402 moaA -221 4.4 GTATGTGAGGGGTGTCACAAAA
Ssed_3872 sel1 -296 4.3 ATTAGTGATATAAGTCAACTAA
Ssed_0094 cytcB -96 4.5 AAATATTACCTCGATCACATAA
Ssed_1334 SO3553 -233 4.1 GTAAGTGCTACGCATCACATTT
Ssed_2474 ycbW -94 4.6 TATTGTTATTCAACTCATATTT
Ssed_3431 nqrA-2 -130 4.1 CAGCGTGATTGCGGTCGCATTT
Ssed_4009 omp35 -151 4.4 AAACATGATCTAGTCCACAATT
Ssed_0623 SO0572 -108 4.1 TTTTTTGACTGAAGTCAAACTT
Ssed_0882 SO0939 -349 4.1 TTTTGCGAACAAAATCACACTG
Ssed_4184 SO1414 -116 4 CTTCGAGATCTGCTTCACGAAT
Ssed_0493 mccA -233 3.7 TTTTTTGAAATGTTTAACCTAC
Ssed_0493 mccA -158 4.2 AAGTGTGCTTTGAAGCAAATTT
Ssed_2927 fahA -116 4.1 GAGCGTGATTCATGTCACACTA
Ssed_2637 SO2589 -51 5.1 AAACGTGATTTCAATCACACTT
Ssed_3491 lipB -75 5.3 AAATGTGATCTAGCTTACATTT
Ssed_0145 prlC -210 4.1 ATTTGAGAAGTAATTCTCAATA
Ssed_0144 null -115 4.2 TATTGAGAATTACTTCTCAAAT
Ssed_1165 hcp -170 3.4 TAATGCAATTGGTATTATAATT
Ssed_4007 SO3895 -200 3.8 TTTTGTGAACTTGATTAACAAG
Ssed_4007 SO3895 -324 5 TTTTGTGATTCTTATCACGCAT
Ssed_1852 SO2753 -257 3.8 AAGTGTGATCTTGGTCGGTAAA
Ssed_1847 SO2757 -226 4.5 ATTTGGGATCAATATCACCTTT
Ssed_2000 SO2535 -191 4.5 TTTATTGATCATAATCACAATT
Ssed_1999 fadE2 -71 4.5 AATTGTGATTATGATCAATAAA
Ssed_2358 fumB -194 3.8 AAATGTGATATTCCCCTAAAAG
Ssed_4286 scyA -145 4.4 AGCTTTGATTGAAATCACAAAA
Ssed_2930 phhA -75 4.8 AACTGTGATGGAGTTAACAAAA
Ssed_1530 mtrD -291 4 TTATGTGACAAAAGTCTCAACT
Ssed_4199 ygbA -187 3.9 TTTTGTGCACATCTTCATACTT
Ssed_0809 astC -141 4.1 AACTGGTATTTTGATCACATTT
Ssed_0809 astC -121 3.9 TTTCGTTATTAATGTCACTTAA
Ssed_0444 purH -282 4 GAGTGTGACGCTCTGCACAAAT
Ssed_0444 purH -191 4.2 TATTGTGAAATCGTGCAGAAAA
Ssed_4166 ilvC -78 4 TATAGTGATCTCAATCACTGCT
Ssed_4116 frdC1 -126 4.5 GTTTGTGATCTGCTTCAAATAG
Ssed_4115 fdrC2 -104 4.4 TGTTTTGATCTGCCTCACGGTT
Ssed_4115 fdrC2 -74 3.9 ATATGTGAGCGACATTATGATT
Ssed_0437 yniC -296 4.2 AAGTTTGAATCAGATCACACTC
Ssed_0791 null -164 3.8 AAGTGTGATCTGACGCCGATTT
Ssed_0791 null -103 3.9 AACTTTGAACTTGTTCAAGTAT
Ssed_1709 Spea_1673 -311 3.9 AGTTGTTAAGTGGCTCCCAATT
Ssed_0216 cymA -86 3.7 CAGTATGATCTAGTTTATAATT
Ssed_3419 Spea_3089 -227 3.9 ATTTCAGATATAAATCAAAAAA
Ssed_3418 Spea_3089 -227 3.8 TTTTGTACTGTTTTTAAAATAA
Ssed_4188 SO1410 -154 3.9 ATTCGCGAGCTCTGTCACGAAT
Ssed_4188 SO1410 -113 4.2 GTGCGTGATCCAATTCACCTTT
Ssed_4007 SO3895 -294 4.6 TTGTGTGATATCAATCATCTTT
Ssed_0094 cytcB -96 4.5 AAATATTACCTCGATCACATAA
Ssed_4426 null -217 4.1 ATGCGTGATCTCTCTCATTTAA
Ssed_4132 cyaA -90 5.2 AAGTGTGATCTTGATCTCATTT
Ssed_3317 SO1539 -103 4.8 AATAGTGAGCAATCTCACATTT
Ssed_0095 engB -95 4.7 TTATGTGATCGAGGTAATATTT
Ssed_0879 cadC -117 4.1 TAACGTGTTCCTTGTCACGAAT
Ssed_1627 SO3090 -316 4.6 AAGTGTGATCTGATTCTAACTT
Ssed_0288 Spea_3921 -42 5 TCTTGTGATACAGGTCACATTA
Ssed_3695 fadD-2 -135 5.4 TAATGTGATCTATTTCTCATAT
Ssed_1186 phk -238 4.4 CCATGTGACGCAGATCACAGTT
Ssed_1186 phk -97 4.2 AAATAAGATGTAGAACACATTT
Ssed_4058 SO4142 -112 4.7 AAAGGTGATCAACATCAAATTT
Ssed_2211 ccoN -177 4.4 TTTTTTGACATAGCTCAAGTAT
Ssed_2523 fadD1 -151 5 TTATGTGATGATGATCATAATT
Ssed_1334 SO3553 -233 4.1 GTAAGTGCTACGCATCACATTT
Ssed_1469 ompW -158 4.5 TTTTGTGAGCTTGGTCATGTAT
Ssed_1333 purE -217 3.8 TATTGTGAAGTCATCCGGATAT
Ssed_3849 cydD -139 4.1 AAAATTGATCTAGCTCAATTTT
Ssed_1525 mtrC -191 4 TAGGCTGATCTAGGTCACACAT
Ssed_4414 SO4520 -203 4 AAACATGACTTGCTTAACAAAA
Ssed_3518 sfcA -87 3.7 AAACGCAACAAAGATCACACTT
Ssed_2877 SO2806 -82 4.5 TAATGTGAATGGCGTCACACAG
Ssed_1560 nadC -127 3.9 AAAATAGATCTACTTCACCTAT
Ssed_3715 null -111 4.2 CAGTGTGATCTCGATCAACTTC
Ssed_1169 yfiA-2 -222 3.8 TTTTGAGAGGCAAATAAAAAAA
Ssed_1169 yfiA-2 -76 4.6 AAACGTGATTTAGATCACGACT
Ssed_2818 sdhC -86 4.2 GATCGTGACCTGTGTCACAGTT
Ssed_4008 Shewana3_0734 -193 4.8 ATGCGTGATAAGAATCACAAAA
Ssed_4008 Shewana3_0734 -223 4.3 AAAGATGATTGATATCACACAA
Ssed_1848 Swoo_2741 -106 4.4 AAAGGTGATATTGATCCCAAAT
Ssed_1830 SO2797 -53 3.8 TTCTGTGACATGGGTTACACTC
Ssed_3566 Sama_2899 -184 5.1 ATGTGTGACCAGGTTCACAATT
Ssed_0816 SO3987 -321 3.9 AAACTCAATATAGTTCACATTT
Ssed_0816 SO3987 -147 3.9 GGATATGATCTAAATCACACTG
Ssed_1130 cyaC -103 4.3 TCATTTGACAAAGATCACAAAT
Ssed_2686 hmgR -116 4.5 ATTTGTGACATACCTATCAATT
Ssed_0706 rarD -88 4.8 TAGAGTGATCCAGCTCACATAC
Ssed_4064 SO4154 -9 4.4 ATATTTGATATGTATCACCTCA
Ssed_2280 apbE -209 4.5 ATATTTGACCCAGTTAACACAT
Ssed_1878 SO2637 -136 4.4 AATTGTGATCTGCGTGGCAATT
Ssed_4183 SO1415 -259 3.9 ATTCGTGAAGCAGATCTCGAAG
Ssed_4183 SO1415 -136 4.1 TTACATGAGGTAACTCACAAAG
Ssed_4177 SO1415 -95 4.2 TTTTGTGGTGTACCTCAAGAAA
Ssed_0331 SO0355 -110 3.9 GAATTTGTCATAGATCACATTT
Ssed_3201 SO1603 -267 4.6 TTATTTGACCTGGATCACGCTT
Ssed_1335 SO3551 -273 4.4 AAATGTGATGCGTAGCACTTAC
Ssed_0457 kefA -154 4.2 ATTCATGATCCACTTCACCTAG
Shewanella woodyi ATCC 51908
Swoo_0885 cadC -145 4.5 CAATGTGATCCTCTTCGCAAAC
Swoo_1222 SO1326 -229 3.8 AAATATGAGTTCTATTGCAAAT
Swoo_4279 scrA -154 4.2 AACTGTGTTATTCATCACGATT
Swoo_3123 feoA -157 4.2 AGTTGGGACTTTTGTCACATAA
Swoo_3123 feoA -272 4.7 AATCGTGACTTATATCACTTAA
Swoo_0885 cadC -232 4.2 AATGGTGAGCTGGATCATGTTA
Swoo_4355 SO0543 -215 3.8 AATTGCTAGATAGATCTCACTT
Swoo_4893 deoR -91 3.8 CTTTTTGATCTTTATCTAGTTT
Swoo_1001 argR -311 4.5 TTTTGTGATGTAGGTCTACATT
Swoo_4512 Sputcn32_0539 -127 3.9 ATTCATGATCCTCTTCACGCAG
Swoo_0793 hemG -123 4.3 AATTGTGATATAGGTAAGAGTA
Swoo_0285 acnB -139 4.4 GAGTGTGATCTGATTCAAACTT
Swoo_1265 SO3421 -234 4.9 AGTCGTGATCTTGATCACGTTT
Swoo_1749 SO3120 -214 4.2 AAACGCGATCTAAGTCACTTAA
Swoo_0327 ppc -111 4.7 AGAAGTGATGTAGAACACATAA
Swoo_4839 hutC -201 4.1 AAGTGTGATCCAACTTGTATTT
Swoo_2048 cdd -82 3.9 AAATGGGAGAAAGATCCCATTA
Swoo_1002 mdh -47 3.8 AATGTAGACCTACATCACAAAA
Swoo_2702 icd -304 3.9 AAGTGTGATCTAAGCCAAGTTG
Swoo_0972 nrfA -154 4.4 AAATGTGAGCAACAACACGTTT
Swoo_3036 putP -86 4.4 GTATATGACCCAGTTCACATTT
Swoo_0508 fdrC -109 4.7 TGATTTGATCTGTCTCACAGTA
Swoo_4740 pckA -100 3.8 AATCGTGACATAGCGCAAAGAC
Swoo_0662 crp -173 3.8 TTAGTTGACTTATATCACTAAT
Swoo_1933 hmgR -116 4.5 ATGTGTGATCTAAGTATCAATT
Swoo_3548 deoA -157 4.2 AAGTGTGATCTAAATCTAGTTG
Swoo_4109 napD -179 4.4 AAATGTGAACTCCATCACGCAC
Swoo_4109 napD -155 3.9 AATATTGATCTTGATCGACTAA
Swoo_3207 ompW -211 4.3 AATTATGACGTCGCTCACTAAA
Swoo_2563 gloA -243 3.8 TTTTATGACTCTATTAATATAA
Swoo_4658 scyA -256 3.8 CAATTTGATATGCTTCCAAAAA
Swoo_3788 Sfri_4035 -106 3.9 TTTGTTGATCTTAATCAAAAAC
Swoo_1282 phk -238 4.4 TCGCGTGATCACGATCACACTT
Swoo_0483 hemC -229 4.6 AAATGAGACCAAGATCACACTT
Swoo_1833 sdhC -87 4.8 ATTTGTGATCTAAATCACGCCT
Swoo_4794 etfD -135 4.7 TTTTGTGACGACACTCACATTC
Swoo_0881 cadC -116 3.7 ATATGAGCGCTAAATCACGCTT
Swoo_0294 SO0439 -78 3.9 AAACAGGACGTAGATCACACTT
Swoo_4456 mccA -160 4 AAGTGTGCTTTAGCGCAGATTT
Swoo_1050 SO3588 -309 3.9 TTGTGTGATAAGGGTCTTGTTT
Swoo_0710 cydD -149 4.1 TTTATTGATCTAGCTCAATTTT
Swoo_2565 null -321 4.9 TTCTGTGACCTGTGTCACAAAA
Swoo_3550 tsx -103 3.7 TGTTGTGCTTTAGCACAGAATA
Swoo_0057 cytcB -96 4.4 AAATATTACCTCGATCACAATA
Swoo_2973 swp_4302 -185 4 TTCAGTGATGTAGAACTCAAAA
Swoo_0239 null -92 4 TAACTTGATTTGAATCAATATT
Swoo_4247 SO3967 -91 3.8 AAGTGTTATAAACATCATTTTA
Swoo_1715 phhA -74 4.7 AAGTGTGAAGTGGTTAACAAAA
Swoo_4477 mccA -87 3.9 AATTGTTAAGTTGTTCAGCTAA
Swoo_4659 ccmA -224 4.2 TTTTATGACTTTAATCAAAGTA
Swoo_0508 fdrC -79 4 ATTTGTGAGCGACATTATCTAA
Swoo_1283 SO3541 -215 4.2 AAGTGTGATCGTGATCACGCGA
Swoo_0967 SO1064 -92 3.8 ATATGATATTCCAATTACATTA
Swoo_0714 SO3774 -176 3.9 AAGAGTGTCCCTCGTCACATTT
Swoo_3320 SO3553 -288 3.7 TCCAGCGACTTAGATCACATTT
Swoo_3466 icd -148 4.3 AAACGTGAGACTGCTCACTATT
Swoo_0968 fkpA -95 4.2 TAATGTAATTGGAATATCATAT
Swoo_4166 petA -129 3.8 TACTATGATCTGCTTCTGATTT
Swoo_4765 SO0141 -240 4 AATCGTGACTTAGATTAGACTT
Swoo_0284 yniC -296 4.2 AAGTTTGAATCAGATCACACTC
Swoo_4819 SO4503 -163 4.3 TTTTTTGAGCTAGATCATCAAA
Swoo_2168 SO2871 -66 4.2 CCTTGTGACTTCGCTCACCTTT
Swoo_3332 Shew_1222 -69 4 GAAGGTGATTAATATCACGTTA
Swoo_0971 narQ -112 4.8 AAACGTGTTGTTGCTCACATTT
Swoo_1750 null -148 4.4 TTAAGTGACTTAGATCGCGTTT
Swoo_4793 moaA -222 4.3 GAATGTGAGTGTCGTCACAAAA
Swoo_0663 sel1 -298 4.3 ATTAGTGATATAAGTCAACTAA
Swoo_0863 SO0919 -196 4.2 AACTGAGAGGTGGATCACATTG
Swoo_2142 ycbW -52 4 TACTTTGATATTGAACAAAATA
Swoo_3617 nqrA-2 -46 4 CAGCGTGATTGCGGTCGCAAAT
Swoo_4860 SO0075 -110 4.6 ATCTGTGATCGGTTTAACACTA
Swoo_2219 resA -140 4.1 ATTTTTGATGCTAATCAAATGA
Swoo_4477 mccA -342 4.2 TTTTGTGACCTCTCTATCCTTT
Swoo_4151 omp35 -149 4.3 AAGTTTGATCTAGTCCACAATC
Swoo_4152 omp35 -241 3.3 AATTATTAACTCTTTCTTAAAT
Swoo_4423 SO4118 -345 3.8 AAGTTTTATCTAGTTAACCCTT
Swoo_4658 scyA -144 3.9 TACTTTGATTAAAGTCATAAAA
Swoo_1718 fahA -133 5 TATTGTGATTTGTGTCACGCTA
Swoo_2030 SO2589 -82 4.2 CAAGGTGATTTATCTCACACAG
Swoo_3714 lipB -74