Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Corynebacteriaceae

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium amycolatum SK46
CORAM0001_0534 mntA -153 6.1 AAGTTCAATGGGTTGAAAAT
Corynebacterium aurimucosum ATCC 700975
cauri_0335 mntR -76 6.5 ATGTTCAATGGATTGAACTT
cauri_0334 mntM -51 6.7 AAGTTCAATCCATTGAACAT
Corynebacterium diphtheriae NCTC 13129
DIP0615 mntA -91 5.6 AAATTCAATACGCTGAACAG
DIP1923 nrdI2 -81 6.7 AAGTTCAATGCATTGAACTT
Corynebacterium efficiens YS-314
CE1566 mntT -34 6 ATGTTCATGCCATTGAACAT
Corynebacterium glutamicum ATCC 13032
cg1623 mntT -34 6.3 CTGTTCAATGCGTTGAACAT
Corynebacterium jeikeium K411
jk1486 mtsA -57 6.4 TTGTTCAATACATTGAACAT
jk1486 mtsA -18 4.6 AGGTTTATTACCTTGAAAAT
jk1485 mntR -86 6.2 ATGTTCAATGTATTGAACAA
jk0226 nrdI2 -123 5.2 AAGTTCAATACATTGTTGTT
jk0226 nrdI2 -100 4.8 AAGTTCGGGTCATTGAACTT
Corynebacterium kroppenstedtii DSM 44385
ckrop_1572 mtsA -177 5.9 AAATACATTGCATTGAACTT
ckrop_1571 mntR -143 5.7 AAGTTCAATGCAATGTATTT
ckrop_3000 nrdI2 -72 5.6 AAGTTCAAGCCATTGAATAA
Corynebacterium urealyticum DSM 7109
cur_0526 mtsB -56 6.6 AAGTTCAATACATTGAACTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD