Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Pseudomonadaceae

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA4055 ribE2 -347 95.3 GTAACGTTCTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAATGGCGCGCAAGGCGCCTAGCCCGCGAGCGCTTGCCGGACCGGCCACCGCCGGACGACAAGGTCAGCAGACCCGGTGCGATTCCGGGGCCGACGGTCATAGTCCGGATAAAGAGAGAACGGGA
Pseudomonas entomophila L48
PSEEN0609 ribB -223 113.5 CAAGGGTCTTCAGGGCGGGGTGAAAGTCCCCACCGGCGGTAAATCGAAAGATGAGCCCGCGAGCGCCCCGGCCATGCCGGGGGTCAGCAGATCTGGTGAGATTCCAGGGCCGACGGTCATAGTCCGGATGAAAGAAGGCGTTT
Pseudomonas putida KT2440
PP0530 ribB -223 111.7 GGTCGGTCTTCAGGGCGGGGTGTAAGTCCCCACCGGCGGTAAATCGAAAGATGAGCCCGCGAGCGCCCCGACCATGTCGGGGGTCAGCAGATCTGGTGCAACTCCAGAGCCGACGGTCATAGTCCGGATGAAAGAAGGCGTCA
Pseudomonas syringae pv. tomato str. DC3000
PSPTO1839 ribH2 -301 100.3 GTAACGTTCTCAGGGCGGGGTGCAACTCCCCACCGGCGGTAATGGCGCGCAATGCGTCTAGCCCGCGAGCGCTTGGGGGTTTCAGCTTTGGCTGACGACCTGCAAGGTCAGCAGACCCGGTGTGATTCCGGGGCCGACGGTCATAGTCCGGATGAAGAGAGAGCGGGA
Pseudomonas fluorescens Pf-5
PFL_4508 ribH2 -291 104.6 AACGTTCTCAGGGCGGGGTGCAATTCCCCACCGGCGGTAATTGCGTGCAATGCGCATAGCCCGCGAGCGCTTGGCGAGACCGGTGGCTTGGCCACAGGTGACGACAAGGTCAGCAGACCCGGTGTGATTCCGGGGCCGACGGTCATAGTCCGGATGAAGAGAGAACGGGATT
Pseudomonas mendocina ymp
Pmen_3856 ribE2 -282 102 GCAACGTTCTCAGGGCGGGGTGAGATTCCCCACCGGCGGTAATGGTTCGCAGAACCTAGCCCGCGAGCGCTCGCCATGGCTTCTGCCAGGCGAGGTCCAGCAGACCCGGTGCGATTCCGGGGCCGACGGTATAGTCCGGATAAAGAGAGAGCGGGA
Pseudomonas stutzeri A1501
PST_0836 ribE2 -269 63 TGAGCACTTCGAGGAGGAGCACAACGCAGCATGCTCTGCGCGCAGTAGCTTTCAATCGCGTCTAGCCCGCGAGCGCTTGCTTCGGCAAGGTCAGCAGACCCGGTGTGATTCCGGGGCCGACGGTATAGTCCGGATGAGAGAGAGCGGGATA
Azotobacter vinelandii AvOP
Avin_06730 ribE2 -273 97.1 GACGTTCTCAGGGCGGGGTGGAATTCCCCACCGGCGGTGATGACGCCCAGGCGTCCAGCCCGCGAGCGCTTGCCACGGGGCAACCCCCGCGCAAGGTCAGCAGATCCGGTGCGATTCCGGAGCCGACGGTCAGAGTCCGGATGAGAGAGAGCGGGATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD