Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Pseudomonadaceae

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas stutzeri A1501
PST_4110 dadA -248 61.8 CGATGTGCTAGCGGGAGAGACTGCCGTCAGGGCAGCGCCGAAGGAGCAACCGCCCCGGAAACTCTCAGGCAAAAGGACCGCTACCA
PST_4110 dadA -162 46.7 CCGCTGAAACTCTGAAGAGCCGCCCGGTTTTCGTCGCCGGGCGCACCGAAGGAGCAAGCGAGCCGTCACGCGCTCGTGAATCTCTCAGGTCCAGAACAGAGGGGGCGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD