Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Pseudomonadaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA2946 cbtA -58 77.8 CTAGGCGGGTTGTCCCAGGTGTCTCGTGCCGGCGCGCACGAGGTGAAACGGGAAGCCGGTGACGCTCTCCGAGCCAGTCCGGCGCTGCCCCCGCAACGGTAAGCGCATCGCGCGCGAGCCCGGAGACCGGCCTGGAACCTTTCGTTTGATTC
PA2906 cobG -252 87.8 GCATAATAGCGCGTTCGTCGGTGCCCGGCCCTTTCGCGTTAGCGCGGGGCCAACGAGGGCCGAAGAGGGAACACGGAGCCGCGGTCTTTTCGAAGCCCGGGCCTAGCCGTGGCTGCCCCCGCAACTGTATGCAGCCTGTATTCGCGCCATTCGCCACTGGATTACCGGGAAGGCGGCGCGAAGCGGAGGTTCCTCCCCCGGGTGGAACGCCGGGCTGCGAGCCAGGAGACCTGCCGCCGAAACCAGTCGCGAG
PA2911 btuB -303 112.9 CCATCCGGCCCGTTCCAGGTGCCTCCTGCCGCCGCGCAGGAGGTGAAACGGGAAGCCGGTGCGTCACTTCGGTGATCAGTCCGGCGCTGCCCCCGCAACGGTAAGCGAGCGAAATCCTCTTCAGGCCACTGTGCTCCGGCATGGGAAGGCGAGGATTTCACGACCCTCGCAAGCCCGGAGACCGGCCTGCAACGCCCTGTTGGCACA
PA2945 null -238 104.6 CGTAGCCTTGCCGGTTCGAGGTTCCTCGCCGGCGACGGCGGGGCTAAGAGGGAACGCGGTCGATGCCGCGGCTGCCCCCGCAACTGTGAACGGCGATCGTTCCCCAATGCCACTGCGTGACGCGGGAAGGCGGGGAACCGGCGGAGACGCCAGACCGTGAGCCAGGAGACCTGCCTCGTCGATCCCGTGGCGC
PA1271 btuB2 -303 82.3 CTGCGCGCCTTGCGACAGGTGCCCCGCAAGGGGTGAAACAGGGAAGCTGGTGCGTTCCGTCGGAACCAGGCCAGCGCTGCCCCCGCAACGGTAGGCGAATCAGACAGCCGCTCGATGACCACTGTGCTCCGGCATGGGAAGGCGCGGCTGGAAGCGTCCAGCGCTTCGCTCGCGAGCCCGGAGACCGGCCTGACGCACCCACGGCATCGC
Pseudomonas entomophila L48
PSEEN3066 btuD -314 109 ATGCGCCCCTTGTTTCAGGTGTCCCTGGCCGCCGTGCCAGGGGTTAAACGGGAAGCCGGTGCCTCGCTCCACGCGAGAAGTCCGGCGCTGCCCCCGCAACGGTAAGCGAGCAAGGCATTCGACAGACCACTGTGCCGCCGGCATGGGAAGGTGGATGCCCGCCCCTCTCGCAAGCCCGGAGACCGGCCTGCAACCTCTGTTTGGCAAC
PSEEN2012 btuB -315 117 CAGATGCGCGCCAGTTTCAGGTGTCCTGCGCCGCCGCGCGCAGGGTGAAACGGGAAGCCGGTGAGTCGTGTTCACGACAAGTCCGGCGCTGCCCCCGCAACGGTAAGCGAGCGAACCCTTCGACAGACCACTGTGCACCCGCATGGGAAGGTGAAGGTTTCATGCCCCTCGCAAGCCCGGAGACCGGCCTGAAGCCTTACTTGGCAA
PSEEN2431 cbtB -333 102.9 TGCTAGCGCATTGCGTTCAGGTGCCCCCTTGGGGTGAAACGGGAAACCGGTGCGTCACGCCTCGCTCTACAAGAGGCAGGACAATGCCGGTGCTGCCCCCGCAACGGTAAGCGAGTGAAGCGTCTAGACCACTGTGCCCGTCGACTTGGCATGGGAAGGTGACGCCAACAACGGAGCCCCGCTCCACCTCGCCAGCCCGGAGACCGGCCTGACACCACATGAACACC
PSEEN2578 cbiW -297 104 CATGCCGCCCAGTTTCAGGTGCCCCAAGTCGCCGCGCTTGGGGTGAAACGGGAAACCGGTACGCGCTTAGCGCCAGTCCGGTGCTGCCCCCGCAACGGTATGCGAGTGATGCCCTCAATCAGACCACTGTGGCCAGCCGGCCATGGGAAGGCGAGGGCATCCAGCCTCGCGAGCCCGGAGACCGGCCTGGAATCTTTTGGCGACAAT
PSEEN1378 btuR -330 96.2 CTTCGCGGCGTGTTTCAGGTGCCCTGTGAACCCAGGTTCGGCAGGGTGAAACTGGGAAGCCGGTGGGCGCCAGCAAGGTGCGATTCCGGCGCTGCCCCCGCAACGGTAGATGAGTCGACGGCTGCGCAAGGCCACTGGATTTCGTGATCCGGGAAGGCGCACGGCCCGGGCATGGCCCCACTCATGAGCCCGGAGACCGGCCTGTCACTGCCAACGGCATCA
PSEEN2432 cobW -299 97.5 TAGCCTTGCCGCTTCGAGGTTCTCCGGCGTTGGCCGGAGCTAAGACGGGAACGCGGTCGATGCCGCGGCTGCCCCCGCAACTGTAGGCACTGGAACGGATCGGCACAGCCACTGCGCACGCGCGGGAAGGCGCCATCCCGCTGGCAATGCTGCCGGCACAGTGCGAGCCAGGAGACCTGCCTCGTGACGTTTTCGACTTTC
Pseudomonas putida KT2440
PP2418 btuF -226 102.8 GTCTACCATGCGGGCCGCCGGTTTCCACCACGGAACTAACAGGGAATCCCAGGCCTGCCAATACAGGCCAATCGGAACTGCCCCCGCAACTGTAGGTGCCGAGCCTGCTCCATCGATGCCACTGGGCCTGCCGCCCGGGAAGGCCGGAGCCGGGCCGTGACGCACCAGTCAGGAGACCTGCCGGCCTACATTCACCAACC
PP1672 btuR -340 87.4 CTTCGCGGCGTGTTTCAGGTGCCCTGCCAGCCCCGACTGGGCAGGGTGAAACTGGGAAGCCGGTGGGCGCCAGCATGGCGCGATTCCGGCGCTGCCCCCGCAACGGTGGATGAGTAAAAGGCCGCGCAGGGCCACTGGATGCCAGCATCCGGGAAGGCGCGCAGGCCAGGGCCAAGGCCCACTCACAAGCCCGGAGACCGGCCTGATACTGCCAACGGCATCA
PP3508 cobW -307 100.8 CGTAGCCTTGCCACTTCGAGGTTCTTCGGCCTGGCCGAAGCTAAGACGGGAACGCGGTACAAGCCGCGGCTGCCCCCGCAACTGTAAGCACCGACAACGGATCGACACAGCCACTGCGCCAACGCGCGGGAAGGCGTCATCCCGCCAGCCCGAACGGGGACATGGAACGGTGCAAGCCAGGAGACCTGCCTCGTCACGTTTTCGACTT
PP2420 btuB -258 119.2 CAGATGCGCGCCAGTTTCAGGTGCCCTGCGCCGCCGCGCGCAGGGTGAAACGGGAAACCGGTGCGTCGTGTTGCCCACGACAAGTCCGGTGCTGCCCCCGCAACGGTAAGCGAGCGAACCCTTCGAGATACCACTGTGCTCAAGCATGGGAAGGTGAAGGTTTCATGCCCCTCGCAAGCCCGGAGACCGGCCTGGAGCTTCACTTGGCAA
Pseudomonas syringae pv. tomato str. DC3000
PSPTO3151 cbtB -309 110.3 CTGTGCACCTTGTTTCGGGTGCCCCTCACGGGGTGAAACGGGAAACCGGTGCGCTCAACCTGTTGAGCAAGTCCGGTGCTGCCCCCGCAACGGTAAGCGAGAGAAGGTCTGATCCACTGTGCTCTGGCATGGGAAGGTGACCTTGAAGGTCTGAACGCACACGTGTTCAAGCCCCTCGCGAGCCCGGAGACCGGCCCGACATTTTTCCAATGACAC
PSPTO3256 btuF -159 123.6 TTACCATGCCGGCCGTCGGTTTCCGAGAGGAACTAACAGGGAATTCGCCAGCTTTGTTTCAAAGGCCAAAACGAAACTGCCCCCGCAACTGTAGGCATCGAGCCTGCTCCAAGACTGCCACTGGATTCAGATCCGGGAAGGCCGGAGCATGGTGATGACATGCCAGTCAGGAGACCTGCCGACCCGATTCAACCAACTAA
PSPTO1708 btuR -304 113.9 CTTCGCGGCTTGTTTCAGGTGCTCTGCAATCCTCGATTGGCAGGGTGAAACAGGGAAGCCGGTGTGGATCGACCGATCCGATCCCGGCGCTGCCCCCGCAACGGTAAATGAGTCAAGGCTGTGCATCGTGCCACTGTGTTTCGACACGGGAAGGCGCGCAGCCGGGGTAACCCGCTCATGAGCCCGGAGACCGGCCTGAACCACTCAATGGCATCA
PSPTO3150 null -339 106.8 CGTAGCCTTGCCGGTTCGAGGTTCTTCATGTGTAAAGCGTTACGACATGAAGCTAAGACGGGAATGCGGTACATGCCGCAGCTGCCCCCGCAACTGTAAACGGTCATGTTCATTGCACAGCCACTGCTGCGGCGGGAAGGCGCGATGAATGTGTGTCGGCAAGGTGTTCAACGCCCGCCACACGCTGCCGTGAGCCAGGAGACCTGCCTCGAACCGGGCTGACAAA
Pseudomonas fluorescens Pf-5
PFL_3655 null -98 94.9 CGTAGCCTTGCGCTTTCGAGGTTCTTCGGCCACGGGTCGAAGCTAAGAAGGGAACGCGGTCGATGCCGCGGCTGCCCCCGCAACTGTGAAGGGTTCGATTGCTGCAAGGCCACTGCATGGGCGTCGACGACGCCGGTGGGAAGGCGCAGCAATCGCCGGTCCGACGACTGGCAAGCCCTCAGCCAGGAGACCTGCCTCGATCCCAGATTCTCAC
PFL_2240 btuB2 -189 126.2 CATATGCCGCCCAGTTTCAGGTGCCTCCTGCCGCCGTGCAGGAGGTGAAACGGGAAACCGGTGCGCCCCTTTTCGGGCAAGTCCGGTGCTGCCCCCGCAACGGTAAGCGAGTGCTGCATTCAACAGGCCACTGTACCCAAGGTATGGGAAGGCGAATGCCGCCAGACTCGCAAGCCCGGAGACCGGCCTGTGACGTCTGTTTGGCA
PFL_4431 btuR -315 105.6 ACCTTCGCGACTTGTTTCAGGTGCTCTGTGGCCCGTGGCCGACAGAGTGAAACAGGGAAGCCGGTCAGGGTCTGTTCCAGTGATGGAGCCGACGACGATTCCGGCGCTGCCCCCGCAACGGTAGATGAGTCAAGACTGCGCCTGACGCCACTGTGTCAATGACACGGGAAGGCGCGCAGTCCGGCAGCCATGCCGCTCATGAGCCCGGAGACCGGCCTGATCCATCCAACGGCAT
PFL_3656 cbtB -156 105.3 CTACACACCTTGTTACGGGTGCCCCTTACAGGGTGAAACGGGAAACCGGTGAATCACGTGCTTAACTAAAAAGCCGTGGCCAGTCCGGTGCTGCCCCCGCAACGGTAAGCGAGCGAAGTGTCAGATCCACTGTGCCAAGGCATGGGAAGGCGACACTTGCTGGCACGGCATGACACAGCCCTGCCCCTCGCAAGCCCGGAGACCGGCCCGCAACACTTACATAACAAC
PFL_2970 btuB -154 123 CATATGCGCGCCAGTTTCAGGTGTCCCATGCCGCCGTGCATGGGGTTAAACGGGAAGCCGGTGCGTCATTTCGATGATCAGTCCGGCGCTGCCCCCGCAACGGTAAGCGAGCGAAGCATTCGACAGACCACTGTGCCAAGGCATGGGAAGGTGAATGCCTCATGACCCTCGCAAGCCCGGAGACCGGCCTGCAACTTCGTTTGACAA
Pseudomonas mendocina ymp
Pmen_4567 btuB -394 118.9 TCATATCCGCCCCGCTTCAGGTGTCTCACGCCGCCGCGCGTGAGGTGAAACGGGAAGTCGGTTGAAGTCCGACGCTGCCCCCGCAACGGTAAGCGAGCGACCGCATCGATACGCCACTGTGCGCCACGCGCATGGGAAGGCGATGCGTTCATGACCCTCGCAAGCCCGGAGACCGGCCTGGAGTCATTTGTCTGGC
Pmen_4571 cobG -184 99.8 GCCTTCGCGGGAGTGACGGTAAATGGCCATTTCAGAAATTCCCCAAGAGGGAACACGGTCAAGCCGTGGCTGCCCCCGCAACTGTAAACAGCGAGTCCAATGCAATCGGCCACTGGGTAACCGGGAAGGCGCGGCGGACGAAGACCTGTCAGCCAGGAGACCTGCCGACGAACGCTGGTCGCGAGT
Pmen_3752 cbtC -258 125.1 GAGTAAGGTTGCCGCCGATGGTTCCGCCGCCTCTGGCGCGCGGATGAAAAGGGAACAGGGTGCGGCGCCGCGTCGCCAATGCCCTGGCTGCCCCCGCAACTGTAAACGGCGTACGACGCTCCCTATGCCACTGGCCGCCAGGCCGGGAAGGCGAGCGAAGTGGCAAGCCGTGAGCCAGGAGACCTGCCATCGGCAAACGGGCGTTT
Pmen_3845 btuB1 -290 82.6 CATTCATGTTCCGCCAGGGTGCGCTGCTGACGCGGCGTGAAACGGGAAGTCGGTGCGCCCATCCAGGCAATCCCGACGCTGCCCCCGCAACGGTAATCGACGGCAGGCCACAGCCTGCACCTTGTCCACGGCCACTGGGTATTCCCGGGAAGGCGGACCGGGGTCGTGAGCCCGGAGACCGGCCCCGGCGGTGCGACTGGTGTT
Pmen_1750 btuR -394 97.3 CTGCGCGCCTTGCTTCAGGTGCCCCGCGTCGTCTCCATCGACGGCGCCGGGGTGAAACAGGGAAGCCGGTTCCAATGCCGGCGCTGCCCCCGCAACGGTAGGTGAGTCAAACGCTGTTTCAGGCCACTGTGCAATGCACGGGAAGGCGCAGCGTCGAACCTTTCAGGTTCGCTCACGAGCCCGGAGACCGGCCTGTCGCAGTTCCACGGCATC
Pmen_4587 null -291 113.1 GTAGCCTTCTCGCTTTCGAGGTTCTTCCCGGCAAGCCGCCGGGGAGCTAAGAGGGAACAGGGTCGATGCCCTGGCTGCCCCCGCAACTGTAAACGGTCGCAACTCCTTCGATACACCACTGCCTCAAGCGGGAAGGTGAAGGACGCACAGCGTGCAGACCGTGAGCCAGGAGACCTGCCTCGATAGACCAGCCACTT
Pseudomonas stutzeri A1501
PST_1289 btuB2 -373 105.7 ACCTCCGCGTCGCCTCAGGTGCCCCCTGGCCTTGTGCCAGACGGGTGAAACAGGGAAGCCGGTCCATTCTCACGAAGATTCCGGCGCTGCCCCCGCAACGGTAGGCGAGTCGAGAAACCGCAACGGCCACTGTGCATGACGCATGGGAAGGCGCGGTTTCGGGATGCCGCAAGGCATACGCTCGCAAGCCCGGAGACCGGCCTGTCGCATTTCACTGACAGT
PST_0846 btuB1 -314 98.5 GCGTTTTCTTATCCGCCCAGGTGTGCACGACCGCAAGGTCCGCATTAAACGGGAAGCCGGTGCGCTCGAAGAGCAAGGCCGGCGCTGCCCCCGCAACGGTAATCGACCGCGATCCTCAGGAATCGCCGTCCGCTCGACAACCACTGTGTTCCGACATGGGAAGGTGAGCGTGATGCGTGTCGAAAGCCCGGAGACCGGCCTGACGGATTCGACTGGTG
Azotobacter vinelandii AvOP
Avin_33130 btuB2-btuM-btuR -310 91.3 CCCTGCGCGCCTCGCTTCAGGTGCCCCAAGGGTGAAACAGGGAAGCCGGTGCGTGCCGCGACCATTCGCGGCGCAAGGCCGGCGCTGCCCCCGCAACGGTAGACGAGTCGCGAAACCGCAATAGCCACTGTGTTGCTCGGACACGGGAAGGCGCGGTTTCGGAAGCCGCCGCATGGCGCTTCGCTCGTGAGCCCGGAGACCGGCCTGTGGCGATCCATGGCGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD