Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Pasteurellales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0883 glyP -303 31.4 GATGAAGGTAGCTGGAGAGCGGGAAATTGACCCCACACCGACGATGTAAAATCTTTCAGGTGCGATGGCAGGGACTGTTAC
HI0883 glyP -222 58.8 TGGACGAACCCTTGGAGAGATCCATTTTAGAAATGGACGCCGAAGCGCAAAAGAGCGGTTAATTTTTCAATCGTTTTTCAAACGCTCAGGCAAAAGGACAGGGGCAAAAGA
Aggregatibacter aphrophilus NJ8700
NT05HA_1471 glyP -218 59.5 GACGAACCCTTGGAGAGATCCGTGTGCAACATTTAGCACTCACGGACGCCGAAGGCGCAAAGAAGCCATAAAAAAGGCTTTTCAAACGCTCAGGCAAAAGGACAGGGGCAGGAGATT
NT05HA_1471 glyP -299 36 TGAAGGTAGCTGGAGAGCGGGGAATTGACCCCACGCCGACGAGGTAAAATCTTTCAGGCGCGATGGCAGGGACTGTTACTG
Pasteurella multocida subsp. multocida str. Pm70
PM0091 glyP -236 63.7 GACGAACCCTTGGAGAGAGCCGTTATATTAAAAAGAGATAAAACGGCCGCCGAAGGCGCAAAAAGAGCGGTTAATTTTTCCGTTTTTTCAAACGCTCAGGCAAAAGGACAGGGGCAACAAGAT
PM0091 glyP -322 30.9 TGAAGGTAGCTGGAGAGTAGGGAATTGACCCTACGCCGACGAGGTAAACTCTTTCAGGCGCTGATTATAAGCAGGGACTGTTACTG
Mannheimia succiniciproducens MBEL55E
MS0353 glyP -311 31.2 GATGAAGGTAGCTGGAGAGTGGGGAATTAACCCTACGCCGACGATGAAAAATCTTTCAGGCGCAAAGTAATTTGCAAGGACTGTTACT
MS0353 glyP -224 62.2 TGGACGAACCCTTGGAGAGATCCAATGTGCTTAGCACAAAATGGACGCCGAAGGCGCAAAAGTGCGGTCAATTTTGACCGATTTTCTTGAAACGCTCAGGCAAAAGGACAGGGGCAAGAGA
Actinobacillus succinogenes 130Z
Asuc_0747 glyP -252 34.8 CGAAGGTAGCTGGAGAGTGAAGAATCGACTTCACACCGAAGAAGCAAAATCTTTCAGGTGCGACATTTGTTGCGGGGA
Asuc_0747 glyP -165 56.2 GACGAACCCTTGGAGAGAGCCGTTCGCATTTTATGCGTGGACGCCGAAGGCGAAAAAGTGGTGACACTTGAAACGCTCAGGCAAAAGGACAGGGGCAAGAGATT
Haemophilus somnus 2336
HSM_0760 glyP -293 29.1 TGAAGGTAGCTGGAGAATGGGGAATTGACCCCAAACCGACGAGGTAAAATCTTTCAGGTGCGATGGCGAGGACTGTTACTGG
HSM_0760 glyP -212 62 GACGAACCCTTGGAGAGATCCAATGTGCAATGCACAAAATGGACGCCGAAGGCGCAAAAGAGCGGTGTTTTTTACTGCTTTTCAAACGCTCAGGCAAAAGGACAGGGGCAAAAGATT
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_1185 glyP -209 53.8 ACCCTTGGAGAGATCCAATCCATGTAGTTAATGGAAAATGGACGCCGAAGGCGCAAGTGCATCAGCATGAAACGCTCAGGCAAAAGGACAGGGG
APP7_1185 glyP -298 37.9 GATGAAGGTAGCTGGAGAAGAGCGATAAGCTCTACCGACGAGGTAAAATCTTTCAGGTGCTAGCAATAGCGAGGACAGTTACTGGACG
Haemophilus ducreyi 35000HP
HD0460 null -36 53.2 CCTTGGAGAGATCCACTCTGTACTATAGTACAGAAAATGGACGCCGAAGGCGCAAATATAAAGCAAATTTATGTGAAACGCTCAGGCAAAAGGACAGGGGAG
HD0460 null -130 29.5 TGAAGGTGGCTGGAGAAGAGTTTAGGCTCTACCGACGAGGTAAAATCTTTCAGGTGCAATAGTTTAACTATGTGAGGACAGTTACTGGACGAA
Haemophilus parasuis SH0165
HAPS_1007 glyP -242 56.9 CCTTGGAGAGATCCACTCTGCATAGCAGAAAATGGACGCCGAAGGCGAAAGCAATGAATGCGAAACGCTCAGGCAAAAGGACAGGGGAG
HAPS_1007 glyP -329 46.3 TGAAGATAGCTGGAGAGTGGGGAATAACCCTACACCGACGAGGTAAAATCTTTCAGGTGCGACAGCGAGGACAGCTATTGGACGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD