Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Pasteurellales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0764 ribB -265 114.1 CGCATTCTCAGGGCAGGGTGAAATTCCCTACCGGTGGTAAAGCCCACGAGCGTTTAAAAGTGCGGTCAATTTTTGGCAAATTTTTCCTGCGAAATTGTCCTGATTTTCACTTTTAAAGTCAGCAGATTTGGTGAAATTCCAAAGCCGACAGTAAAGTCTGGATGAAAGAGAATAAAACG
Aggregatibacter aphrophilus NJ8700
NT05HA_1865 ribB -266 112.1 CGCGCATTCTCAGGGCAGGGTGAAAGTCCCTACCGGTGGTGAGCGTGTTAACGTAAGCCCACGAGCGTTTGAGACAAAAGTGCGGGTGATTTTTCCCGTGTTTTTCTCAAAGTCAGCAGATTTGGTGTGAATCCAAAGCCGACAGTGATAGTCTGGATGAAAGAGAATAAAA
Pasteurella multocida subsp. multocida str. Pm70
PM1385 ribB -273 124 TGCGCATTCTCAGGGCAGGGTGAAATTCCCTACCGGTGGTAAATGTATAACATAAGCCCACGAGCGTTTACTATTTCATGTCACAAGAGATAGTAAAGTCAGCAGATTTGGTGAGAATCCAAAGCCGACAGTATAGTCTGGATGAAAGAGAATAAGC
Mannheimia succiniciproducens MBEL55E
MS0172 ribB -248 117.3 GGCATTCTCAGGGCAGGGTGAAATTCCCTACTGGTGGTATATGTTTACATAAGCCCACGAGCGCCTATTTTTATGTGATGTAGAATTAGGGTCAGCAGATTTGGTGAGATTCCAAAGCCAACAGTTAAAGTCTGGATGAAAGAGAATAAAAAA
Actinobacillus succinogenes 130Z
Asuc_0488 ribB -203 115.7 CGCATTCTCAGGGCAGGGTGAAATTCCCTACTGGCGGTCAAGCCCGCGAGCGTTTGTTATAAGGCAAAGTCAGCAGATTTGGTGAAATTCCAAAGCCAACAGTTACAGTCTGGATGAAAGAGAGTAAACCG
Haemophilus somnus 2336
HSM_1983 ribB -252 129.9 TGCATTCTCAGGGCAGGGTGAAACTCCCTACCGGTGGTAAATATTTCGATATAAGCCCACGAGCGCTTACTTATCTTAGTAAGGTCAGCAGATTTGGTGAAAATCCAAAGCCGACAGTGATAGTCTGGATGAAAGAGAATAGAGCG
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_0406 ribD -212 125.4 ATAATCTTCAGGGCAGGGTGAAATTCCCGATCGGCGGTAAAGTCCGCGAGCCGAACGAAAAAGGTTTGGCAGGAACCGGTGAGATTCCGGTACCGACAGTATAGTCTGGATGGAAGAAGATGAAATT
Haemophilus ducreyi 35000HP
HD1161 ribD -295 108.9 TTAATCTTCAGGGCAGGGTGAAATTCCCGATCGGTGGTAAAGTCCGCGAGCCGAACTTCGATTAACATCAAGTTTAGCAGGAACTAGTGAAATTCTAGTACCGACAGTATAGTCTGGATGGAAGAAGAGCAGAAA
Haemophilus parasuis SH0165
HAPS_1134 ribD -377 106.1 TTAATCTTCAGGGCAGGGTGAAATTCCCGATCGGCAGTAAAGTCTGCGAGCGGCGGCGAAAGCCAAAGCAGGAACTGGTGAAATTCCAGTACCGACAGTGATAGTCTGGATGGAAGAAGAGCTAGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD