Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator His_leader in Pasteurellales

Properties
Regulator family: RF00514
Regulation mode:
Biological process: Histidine biosynthesis
Effector:
Regulog: His_leader - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0325 yuiF -218 77.4 CATCATCACCATTCAACTGAATAATCTTTCAGGTTTTTGGTGTGCTTGGAAGATTTCTTCCGAGCTGACAGGATAATAAAAATCTTACCCCTCGGAAGGCAACTTTCGAGGGGTTTTGTTTTA
HI0468 hisG -165 65.2 CATCATCACCACACCTGATTATCTTTCAGGCGTGATTGTATGTTTGGAAGATAATAAAATATCTTCCGAGTGTAATAAAAATCAGTGTAAAAGCAATAAATACCCCTCGGAAGGCAATTTTCGAGGGGTTTTCTTTTA
Aggregatibacter aphrophilus NJ8700
NT05HA_1777 hisG -173 61.1 ACCATCATCACCGTTTACCTGAATAATCTTTCGGGCATTCGGCGTGTTCGGGAGATAACTTCCGAGTACGAGTGAAATGCAGACATAATCAATCACCGTTTAAACAACCCCTCGGAAGGCAACTTTCGAGGGGTTTTGCTT
NT05HA_1368 yuiF -230 61.1 CATCACCACCATGTAACTGAATGATCTTTCAGGTATTTGGTGTGCTTGGAAGATAACTTCCGAGCAGGTACGAATAAATCATTGCATATCGCCCCCTCGGAAGTCCGCTTTCGAGGGGGTTTCTTTTT
Pasteurella multocida subsp. multocida str. Pm70
PM1195 hisG -163 65.6 CATCACCATCTACCCTGATTATCTTTCGGGTATTTTGTGATGCTTGGAAGATAACAAATCTTCCGAGTGTGCGATAAAATGACGAACAATATAAACCTCTCGGAAGCCATTTCGAGAGGTTTTTTTATCAC
Mannheimia succiniciproducens MBEL55E
MS1893 hisG -181 73.1 CTCATCACCATCATCACCCTGATTGATCTTTCGGGCGTTTTGTGGTGTTCGGAAGAAAAGAAAACTTCCGGGCAAGTGTGGAAACAGGATTGCTAAACCTCTCGGAAGGAAACTTTCGGGAGGTTTTTTTA
Actinobacillus succinogenes 130Z
Asuc_0630 hisG -166 53.9 CATCACCGTCATTATTCCTGAACATTCTTTCGGGCATAATGCGGTGTTCGGAAGAAAACTTCCGAGCAAGCGTTAGTTCTAAAATATTCAATCTCTCGGAAGTGATTTTCTACTTTCGAGAGATTTTTTTTTA
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_2106 hisG -178 47.6 CATCACCATCATTCAAGCTGATATCTTTCGGGCATTTGAGTGTGGTCGGAAGATAGAAAATCTTCCGAGTACGTATAAAGCAAAATCGCATATCGCAGCAAAATACACAACCTCTCGGAAGGCAACTTTCGAGAGGTTTTTTATAT
Haemophilus parasuis SH0165
HAPS_0311 yuiF -195 51.4 ACCGTCATCACCATTTACCTGAATAATCTTTCGGGCATTTGGCGTGTTCGGAAGAAACTTCCGAGCGGTGCAAAATGAGAGTAGATCTAAAAACCAATTTCCACCCCTTCGGAAGATGATTTCGAAGGGGTTCTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD