Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Leu_leader in Pasteurellales

Properties
Regulator family: RF00512
Regulation mode:
Biological process: Branched-chain amino acid biosynthesis
Effector:
Regulog: Leu_leader - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0986 leuA -225 17.7 TTTATTTATGTTTCGTATTGTTTCTTTATCTCTCAACCTACTGCTCTCACATTTTGTGTGCGGCTAAGTTGTGGATAAAAAAACAGTCAGATGTAAATACCCAATTTTAAACCCGCACTTTATAAGTTGCGGGTTTTTTA
Aggregatibacter aphrophilus NJ8700
NT05HA_1565 leuB -98 18.9 CTTCGTAGGGACAGGCTTTATGCCTGTCCAATATTAACGAGTAATCGGACAGGCATAAAGCCTGTCCCTACTAAATAACAAATAAAGGATAATTCAATAT
NT05HA_1564 leuA -201 15.7 AGGATTTTTTTATGTTTCACTCTGTTTCTTTATCCCTCAACCTGCTGCTCTTACATTCTTTGTGCGACTAAGTTGTGGATGAAAAACAGTCAAATGTAAAACCCTCAAGATTTAAACCCGCACTCTAATTTGCGGGTTTTTTCGT
Pasteurella multocida subsp. multocida str. Pm70
PM1962 leuA -204 22 TACTTATGTTTACCATGTGTTCTTTATCTCTCAACCTTCTGCTCACACAGTCATTGTGCGGCTAGGTTGTGGATAAAAAACAGTAAAATATCCCACAAATTAGACCCGCACATGTAAGCGGGTCTTTTT
Mannheimia succiniciproducens MBEL55E
MS0599 leuA -181 26.6 TTTTATCTTTATGTTTTCAATATCATCTTTATCTCTCAACTTATTACTCCTCTCACATTCTGTGTGCGGCTAATCGGTTGTGGATAAAAAACGGCAAATGTAAAGATTCCATAAATTAAAACCCGCACTTCAAAATGGCGGGTTTTTTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD