Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Pasteurellales

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0640 rplJ -169 21.1 GACCTATTCAAGCCCCATCCAAGACCGTAGGGGAGTAATCTTAATTATCCTACGTAGATGGTGAACAGAATAAGAATTTTTCTTGCTTCTGGG
Aggregatibacter aphrophilus NJ8700
NT05HA_1815 rplJ -173 20.9 TGACCTCATTCAAGCCCCGTCCAAGACCGTAGGGGAGCAATCTTAATTATCCTACGTAGATGGTGAACAGAATAAGAATTTTCTTGCTTCTGTGCACCGAGTTCGTCCTAATAGCAGTTTTATTAGGTATCT
Haemophilus somnus 2336
HSM_0038 rplJ -194 20.1 TGACCTCTCAAGCCCCGTCCAAGACCGTAGGGGAAAGAGTATTTCTTAATAATCCTACGTAGATGGTGATACAGAATAAGAATTTTTCTTGCTTCTGTGCACCTTAGCCTCAGAGAAGACTGCAAAAGTGCGGTGTTTTTTTGAGAAGTTTTATAATTCCGATCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD