Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator His_leader in Vibrionales

Properties
Regulator family: RF00514
Regulation mode:
Biological process: Histidine biosynthesis
Effector:
Regulog: His_leader - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC1132 hisG -170 72.7 CATCACCATCATCATCCCTAAGGTGTCTTTCGGGAGATGTACGCATACCCGGGGGACAGGAATCTCCCGGAGTTGAAATCAGAGCCATAAAAAGATTCTAACCCTCGGGAGACCAAACCTCCCGAGGGTTTTTCG
Vibrio vulnificus CMCP6
VV1_2920 hisG -181 79.3 TTCATCACCATCATCACCCAGTCTAGTCTTTCGGGAGATGTACGCATACCCGGGAGATAGGAAACTCCCGGAGGTGAAAATCATCAAATTCAGATTTTAAACCCTCGGGAGACCAACATCTCTCGAGGGTTTTTTAGT
Vibrio harveyi ATCC BAA-1116
VIBHAR_01830 hisG -191 73.6 CATCACCATCATCACCCAATATAGTCTTTCGGGAGATGTACGCATACCCGGGAGATAGGATACTCCCGGAGGTGAAAATCAAAGTAAAAACAGATTTCAAACCCTCGGGAGACCAAAATCTCTCGAGGGTTTTTTAGTTT
Vibrio parahaemolyticus RIMD 2210633
VP1137 hisG -173 76.9 CATCACCATCATCACCCAGCCTAGTCTTTCGGGAGATGTACGCATACCCGGGAGGCAGGAAACTCCCGGAGGTGAAAATCAAAGTAAGAACAGATTTTAAACCCTCGGGAGACGCCAATCTCTCGAGGGTTTTTTAGTTT
Vibrio shilonii AK1
VSAK1_00185 hisG -176 85.9 CATCACCATCATCACCCAGCTTAATCTTTCGGGAGATGAACGCATACCCGAGAGATAGGTAAAACTCTCGGAGGTTCGATTTAAGATTTAAAGAATTAAACCCTCGGGAGACCAAAGCTCCCGAGGGTTTTTTCGTTT
Vibrio splendidus LGP32
VS_2026 hisG -172 67.5 TTCATCACCATCATCACCCTATCTAGTCTTTCGGGGAGATTTACGTATACCCGGGAGCAAGAATTCTCCCGGAGGTTAAGTCAAAGAATTTAGATTTAAACCCTCGGGACGACAAAGTCTTCCGAGGGTTTTTTAGT
Vibrio fischeri ES114
VF_1012 hisG -244 78.2 CATCACCACCATCATCCTGATTAGTCTTTCGGGAGGATACGTATTATCCGGAAGGCAATTTGAATTTCCTTCCGATGAATAAAAATTCTAACCCTCGGAAGGTCAAACTTCTGAGGGTTTTTTC
Vibrio salmonicida LFI1238
VSAL_I1133 hisG -198 77.9 CATCACCATCACCATCCTGAGTAGTCTTTCGGGAGGATACGTTATATCCGGAAGGCAATTAGAATTTCCTTCCGATGAATAAAATTTCAAACCCTCGGAAGGTAAAACTTCTGAGGGTTTTTTCG
Vibrio angustum S14
VAS14_17946 hisG -178 84.1 ATCATATTCATCATCATCCTGACTAGTCTTTCGGGAGGATACGCCTCACCCTGGAAGACAACATTATCTTCCAGTGGTCACAAGGAATAATCAAATTCAGACCCTCGGAAGATACAAGCTTCCGAGGGTTTTTTAAT
Photobacterium profundum SS9
PBPRA1092 hisG -189 80.2 TACATCACCATCATCATCCTGACTAGTCTTTCGGGAGGATACGCCTCACTCTGGAAGACAACCAAAAACTCTTCCAGTGTTTGATAAAATAAAGAATTCAAACCCTCGGAGAGCAACACTTCCGAGGGTTTTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD