Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Vibrionales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC0156 btuB -246 104.8 ACTATCAGCGCCAAGCTGGTGCTATTTAGATGCCTGGATGGCTAAAAATGGCTGAAAAGGGAATCCGGTGTAACTCCGGAACTGACGCGCAGCGGTAAGAGAGAACGAACGCTCAAACGACACTGCTTTTCGAGTGGGAAGTCGAGCCAGTAGGCCAACAGTGCTCTCAAGTCCGAAGACCTGCCAGCAACTGAGTTATGCAGTG
Vibrio vulnificus CMCP6
VV1_1173 btuB -249 101.8 AGTATGCGCTTCAAGCTGGTGCTATCTGGAAGTATAGATGGCTGAAAAGGGAATCCGGTGTGAATCCGGAACTGACGCGCAGCGGTAATAGAGAACGAAAGCTTAATCAGACACTGCACGATGGAATCGTGTGGGAAGTCAGGCAAGTAGGTTAACAGCTCTTGAGTCCGAATACCTGCCAGCAACTGAGCAAACACTGG
Vibrio harveyi ATCC BAA-1116
VIBHAR_00261 btuB -260 99.9 ATAGTATTTGCCCCAAGCTGGTGCTATCTAGCAATCTAGATGGCTGAAATGGGAATCTGGTGAGAATCCAGAACTGACGCGCAGCGGTAAAAGAGAACGAACGCTCATCAAGACACTGCATTAGTTTATGTGGGAAGTCGAGTAAGTAGGCGGTACAACCTTGCTCTTAAGTCCGAATACCTGCCAGCAACTGAGCCACAGCA
Vibrio parahaemolyticus RIMD 2210633
VP2938 btuB -260 100.2 ATAATATTTGCCTCAAGCTGGTGTCATCTAGCAATCTAGATGGCTGAAATGGGAATCTGGTGAAAATCCAGAACTGACGCGCAGCGGTAAAAGAGAACGAACGCTCATCACGACACTGCATTAGTTTATGTGGGAAGTCGAGCAACTAGGTGGTGTAAACCTCGCTCTTCAGTCCGAATACCTGCCAGCAACTGAGCCACAGCA
Vibrio shilonii AK1
VSAK1_13281 btuB -261 98.9 TACCATTCCGCCTAGCTGGTGTGAGAATGACAAAGGAATCTCACTGAAAAGGGAATCTGGTGTAAATCCAGAACTGACGCGCAGCGGTAAAAGAGAACGACCCCTCAAATGACACTGTACGAGTTACGGGAAGTCGAGGCAGTAGGTTTAGGTTCACTGTGATCCTTACGCTCTTGAGTCCGAATACCTGCCAGCAGCCAAGCTTCGTTAAC
Vibrio splendidus LGP32
VS_2661 cbiD -223 83 GGGAATCAGGTGTAACTCCTGAACTGTACCCGCAGCTGTAAGCGATGAGCCCTTTACAAGCCACTGAGTCACACGACTTGGGAAGGAGTAAAGCGCAATGAGAACCTCAACATCGTAAGTCAGAATACCTGG
VS_2998 btuB -244 100.5 ATACTATTTCCGGCAAGCTGGTGCCATGTGGATGTATAGATGGCTGAAGAGGGAATCTGGTGAAAATCCAGAACTGACGCGCAGCGGTAAAAGAGAACGAGTATTCATAGACACTGCAAATAGCATTTTGTGGGAAGTCGAATATTAGGTAACCGAAAGGTTGTGCTCTTAAGTCCGAATACCTGCCAGCGGCTAAGCCATACAA
Vibrio fischeri ES114
VF_A0973 btuF -150 31.5 GATAGAATATCTCAACATAGCATCGTACAATGAAGATTACTTCGGAATACGGTGAGAATCCGTAACGGGCGCGCCACTGTGAGAGCTTGCAAGAGTTTGAGTCAGATACGAAGTTGGTTCATATTATGTACG
VF_2435 btuB -265 91.9 CTACTATTTCGCCCATGTTGGTGCGCTATTTTTAATTATAGCCTGAATAGGGAATCTGGTGAAAATCCAGAACTGACGCGCAGCGGTAAGAGAGAACGAAGGTACAATTTTTCACACTGTTAATTTTAGATGTTTAAGGATATCGACGAATAATGGGAAGTGAGTACTCTAGGTTAACTGCTCTCAAGTCCGAAGACCTGCCAGCAATAAGTAATACATT
Vibrio salmonicida LFI1238
VSAL_II1074 btuF -127 29 GAATACGGTGAAACTCCGTAACGGGCGCGCCACTGTAAGAATACATTGAGTATTTAAGTCAGATACGA
VSAL_I2886 btuB -277 75.2 CTACTATTTCGGCCATGTTGGTGCGCTATTTTTAAATTTAATAATAGCCTGAAAAGGGAATCTGGTGTGAATCCAGAGCTGACGCGCAACGGTAAGAGAGAGCTAGGTAATAGGCATCATCCAAACGGTTGTTTTTCTGTATATAAGGATATAGGAAAAATAATGGGAAGTGACTCCCGCCTAAGTTCATTATTCTCAAGTCCGAAGACCTGCCAACAATAAGCAATACATG
Vibrio angustum S14
VAS14_23134 btuB -272 56.3 AGCATCTGCCCTGCGCTGGTTAACCATGGGATGGTACGGGAATACGGTGAAAATCCGTAACTGACGCGCAGCGGTAATAGAGAACGAACGCACACGGATGTATTCCAAACACTGTTTTAACAATATGTTTAATCAATAAAGATTGAATGATGTATTGTTGAGATGGGAAGTTGATGCCTAGGCGACCTTCTTCAGGTCATGCTCTTAAGTCCGAATACCAACCAGCGGTAAAGCACTCTTGCT
Photobacterium profundum SS9
PBPRA3464 btuB -263 62 ACTAGCATCGCAGTGCGCTGGTCTGCCAAATATGGCTAGGGAACACGGTGAAATTCCGTGACTGACGCGCAGCGGTGATAGAGAACGAAAGCACACGGACGTAAGTTCCAAACACTGTTTCAGACAATTGCGCAATGCAATCGGTATGAAGCGGGAAGTTGTTGCCTAGGTGGTTACCCAATCATGCTCTTAAGTCCGAAGACCGACCAGTGTACAAAGCAAATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD