Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Glycine in Vibrionales

Properties
Regulator family: RF00504
Regulation mode:
Biological process: Glycine metabolism
Effector: Glycine
Regulog: Glycine - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC1422 glyP -193 72.3 TGGAGGAACCTCTGGAGAGAACCGTTTAATCGGTCGCCGAAGGAGCAAGCTCTGCGCATATGCAGAGTGAAACTCTCAGGCAAAAGGACAGAGGAGTGAAA
VC1422 glyP -324 25.3 GTTGAAGACTGCAGGAGAGTGGTTGTTAACCAGATTTTAACATCTGAGCCAAATAACCCGCCGAAGAAGTAAATCTTTCAGGTGCATTATTCTTAGCCATATA
Vibrio vulnificus CMCP6
VV1_2695 glyP -366 29 TGAAGGCTACAGGAGAGTGGTAATTAACCATATTTTAACATTTGGTTAGTCATACCCGCCGAAGAAGTAAATCTTTCAGGTGCAATATTCTTATTGGTTATATCAAGAGAATATGCGAGGACTGTAGTTGGAGGAA
VV1_2695 glyP -229 64.6 CTCTGGAGAGAACCGTTAAATCGGTCGCCGAAGGAGCAAGTCCTGCCCATGTGCAGGGTGAAACTCTCAGGCAAAAGGACAGAGGAG
Vibrio harveyi ATCC BAA-1116
VIBHAR_02469 glyP -210 63.8 CTCTGGAGAGAACCGTTAAATCGGTCGCCGAAGGAGCAAGTCCTGCACATTTGTGTAGGGTGAAACTCTCAGGCAAAAGGACAGAGGAG
VIBHAR_02469 glyP -326 29 TGAAGACTGCAGGAGAGTGGTTATTAACTAAATTTTAACATTTAGTTAGGGTAACTCGCCGAAGAATTAACTATTTCAGGTGCTACCTTGGTAGCGGGGACTGTAGTTGGAGGAA
Vibrio parahaemolyticus RIMD 2210633
VP1741 glyP -211 63.3 CTCTGGAGAGAACCGTTAAATCGGTCGCCGAAGGAGCAAGTCCTGCACATGTGTGCGGGGTGAAACTCTCAGGCAAAAGGACAGAGGAG
VP1741 glyP -327 30.2 TGAAGACTGCAGGAGAGTGGTTATTAACCAAACTTTAACATTTGGTTAGATTAACTCGCCGAAGAATTAACTATTTCAGGTGCTACCTTGGTAGCGGGGACTGTAGTTGGAGGAA
Vibrio shilonii AK1
VSAK1_25755 glyP -246 71.7 TGGAGGAACCTCTGGAGAGAACCGTTAAATCGGTCGCCGAAGGAGCAAGCTCATTTCATGTAATGAGTGAAACTCTCAGGCAAAAGGACAGAGGAGAGAAT
VSAK1_25755 glyP -387 23.8 GTTGAAGACTGCAGGAGAGTGGTTTATTAACCTTGCATTAACATTTGGTTAGTATGACCCGCCGAAGAAGTAAATCTTTCAGGTGCTTTATTCTGAGAAATCAGAGC
Vibrio splendidus LGP32
VS_1291 glyP -387 32.8 GATGAAGACTGCAGGAGAGTGGTTTTTAACTAAATATTAACATTTAGTTAGATAAACCCGCCGAAGAAGTAAATCTTTCAGGCGCTTTGTGCTGGAGAAATCCA
VS_1291 glyP -264 66 TGGAGGAACCTCTGGAGAGAACCGTACTACTTTTTTTGTAGCAAGCGGTCGCCGAAGGAGCAAGCTTAGTGCCCGTTACTTATCTATAAGTGATTCGCTAAGTGAAACTCTCAGGCAAAAGGACAGAGGAGTGGAA
Vibrio fischeri ES114
VF_1454 glyP -194 62.7 TCTGGAGAGAGCCGTTAAATCGGCCGCCGAAGGAGCAAGCCCTTATCTGAAAAATGATAAAGGTGAAACTCTCAGGCAAAAGGACAGAGGA
VF_1454 glyP -312 32.7 TGAAGACTGCAGGAGAGTGGCAAAAACCGTCAAGGTTACGCCCGCCGAAGAAGTAAATCTTTCAGGTGCCGAGTTCATTTTTTAAGTGAATAAGGTGAGGACTGTAGTTGGAGGAA
Vibrio salmonicida LFI1238
VSAL_I1796 glyP -193 62.1 TCTGGAGAGAGTCGTTAAATCGACCGCCGAAGGAGCAAGCCCTTATCTGAAAAATGGTAAAGGTGAAACTCTCAGGCAAAAGGACAGAGGA
VSAL_I1796 glyP -309 35.5 TGAAGACTGCAGGAGAGCGGCAACGCCATTATTTGGCAACGCCCACCGAAGAAGTAAATCTTTCAGGTGCCTAATTCAAAACCATGAATAAGGTGAGGACTGTAGTTGGAGGAA
Vibrio angustum S14
VAS14_01791 glyP -171 72.2 TGGAGGAGCCTCTGGAGAGACTCGTTAAATCGAGCGCCGAAGGAGCAAGCCCTATATGGGTGAAACTCTCAGGCAAAAGGACAGAGGAGATAAG
VAS14_01791 glyP -328 32.2 GATGAAGACAGCAGGAGAGCGGCAAAAGAAATTACCATGATGGTATCTCTTACGCCCGCCGAAGAAGTAAGCGTTTGAAGCAGTTGAGCCCTCAACTTATTAAACCGTAAATCTTTCAGGCACCATGTCGTATTTTACGA
Photobacterium profundum SS9
PBPRA2132 glyP -197 73.3 GAGGAGCCTCTGGAGAGACCCGTTAAATCGGGCGCCGAAGGAGCAAGCTTTCCTTTTTGCTGTTTTAACATGCATGGAAAGTGAAACTCTCAGGCAAAAGGACAGAGGAGATAAGAT
PBPRA2132 glyP -375 26.3 TGAAGATAGCAGGAGAGTGGCATATTATTCGCTAGCAGAATCATTCTGATACGAGTATAAGCCCGCCGAAGAAGTAAGCGTTCTTAAACCGTTTGTTACTGTTCAAACACAAGACGTTAATCTTTCAGGCACTGGATTACATACC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD