Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GEMM_RNA_motif in Vibrionales

Properties
Regulator family: RF01051
Regulation mode:
Biological process: Second messenger response
Effector: Cyclic diguanylate
Regulog: GEMM_RNA_motif - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC1722 tfoX -199 68.7 CACGCACAGGGCAAACCATTCGAAAGAGTGGGACGCAAAGCCTCCGGCCTAAACCAGAAGACATGGTAGGTAGCGGGGTTACCGATGG
VCA0811 cbp -223 54.6 TCACACTTTGGCAAACCCTTTGAAAAAATGGGACGCAAAGCTTCCGGTCTGTCGGTCAAGAAAGCTCATAAAGCCCTATTACACCTAGGATAGCGGGGTTACCAATTC
Vibrio vulnificus CMCP6
VV1_2136 tfoX -205 67.8 GTCACGCACAGGGCAAACCATTTGAAAAAGTGGGACGCAAAGCCTCCGGCCTAAACCAGACGTTTTTTGGTAGGTAGCGGGGTTACCGAT
VV20044 cbp -231 63.3 CATCACACATAGGCAAACCTTCTGAAAAGATGGGACGCAAAGCTTCCGGTCTGTCGGTATTTTTATCATACCCAAGATAGCGGGGCCGCCGCT
Vibrio harveyi ATCC BAA-1116
VIBHAR_01580 tfoX -207 67.8 GTCACGCACAGGGCAAACCATTCGAAAGGGTGGGACGCAAAGCCTCCGGCCTGAACCATCGAATTAGATGGAAGGTAGCGGGGTTACCGAT
Vibrio parahaemolyticus RIMD 2210633
VPA1598 cbp -204 51.5 TCACATTTCGGCAAACCATTCGAAAGGATGGGACGCAAAGCTTCCAGTCTGCCAGCACTGCTTAACTAGTCAACACTAGTGCTTAAGATAACGGGGTTGCCACTTT
VP1028 tfoX -207 69.3 GTCACGCACAGGGCAAACCATCCGAAAGGGTGGGACGCAAAGCCTCCGGCCTGAACCATAGTAGTATATGGAAGGTAGCGGGGTTACCGAT
Vibrio shilonii AK1
VSAK1_04062 tfoX -204 72.7 GTCACGCACAGGGCAAACCACTTGAAAGGGTGGGACGCAAAGCCACCGGCCTAAACCAAATTTATTTGATAGGTAGCGGGGTTACCGAT
Vibrio splendidus LGP32
VS_1087 tfoX -214 72.3 GTCACGCACAGGGCAAACCACTTGAAAAAGTGGGACGCAAAGCTTCCGGCCTAAACCACTCGTTGGTATGGTAGCGGGGTTACCGAT
Vibrio fischeri ES114
VF_1573 tfoX -210 72.7 CACGAACATGGCAAACTACATGAAAATGTAGGACGCAAAGCTTCCGGCCTAAGTATTTATATAAGGTAGCGGGGTTGCCGACGG
Vibrio salmonicida LFI1238
VSAL_I1982 tfoX -212 63 GTCACGAACAGGGCAAACTGTGCGAAAGCTCAGGACGCAAAGCTTCCGGCCTACGTATTTATATAAGGTAGCAGGGTTGCCGAT
Vibrio angustum S14
VAS14_03998 tfoX -224 74.2 TCACGAACTGGCAAATTAATTGAAAGATTAAGACGCAAAACCACCGGCCTAAAAATTATGTTAATAATTCAAGGTAGCGGGGTTACCGAAGG
Photobacterium profundum SS9
PBPRA2288 tagA -187 80 TATGTAAAGGGCAAACTAGTCGAAAGGCTAGGACGCAAAGCTACCGGTTTAAGGGTTATTAAGACCTATGACAGCGGAGCCGCCATAGC
PBPRB0312 cbp -155 59.2 CACATTGTTGGCAAACTATCCTAAAGGGTAGGACGCAAAGCTTCCGGTCTGTCGACGTCAGTCTATGATAGCGGGGTTACCGTCTT
PBPRA2110 tfoX -225 72.5 ACGAAACAAGGCAAACTATTCGAAAGAATAGGACGCAAAGCTTCCGACCTAAAAGGTATTATTTGTGTCTTAAATAATAAACCTCATGGTAGCGGGGTTGCCGATGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD