Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Leu_leader in Vibrionales

Properties
Regulator family: RF00512
Regulation mode:
Biological process: Branched-chain amino acid biosynthesis
Effector:
Regulog: Leu_leader - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC2490 leuA -185 35.7 ATGACAATGCGTTTTTCTCTCCTGCTAGGCCTACTACTGATCGTGGAACCATCACGCGGGTAGGCTGTGGACGAAAAACACCACACAAGATAAAAAACCCGCAGCTGATGCGGGTTTTTTTAT
Vibrio vulnificus CMCP6
VV1_0654 leuA -190 29.8 AAGATGACAGCACATTTTTCTTTCCTACTGAACCTCCTCCTCATCGTGACAAGATCGCGCGGGTAGGCTGTGGAAGAAAAATAAACCACACAGAATAACAACTAGCCCGCACATCGATGCGGGCTTTTTTAT
Vibrio harveyi ATCC BAA-1116
VIBHAR_00817 leuA -111 35 CAACTATGTCAGCTCGTTTTTCTATCCTGCTTAGCCTCCTCCTTATCGTGACCAATTCGCGCGGGTAGGCTGTGGAAGAAAAATAACCACACCAATTTCTAAGAAACCCGCATGCAAATGCGGGTTTTTTT
Vibrio parahaemolyticus RIMD 2210633
VP0346 leuA -197 36.7 CAACTATGTCAGCTCATTTTTCTATCCTGCTTAGCCTCCTCCTGATCGTGACCAGTTCGCGCGGGTAGGCTGTGGAAGAAAAATAACCACACCAATTTCTTAGAAACCCGCATGAAAATGCGGGTTTTTTT
Vibrio shilonii AK1
VSAK1_07754 leuA -185 39.5 CATAACAGTGTCATTACGTTTTTCTCTACTCCTGAACCTCCTCCTTATCGTGAAAACATCGCGCGGGTAGGTTGTGGACGAAAAACACCACTAAGAATTCTAAAAAAACCCGCTTAGACAAGCGGGTTTTTTT
Vibrio splendidus LGP32
VS_0380 leuA -128 22.1 TCAAGAACTACACAAATATTAAAACCCGCACTGAGCGGGTTTTTTT
Vibrio fischeri ES114
VF_0295 leuA -174 36.8 ATGAAAACAGTATCTTCTTTTGCTCTAAACCTCCTCCTGATCGTGAACATCTCACGCGGGTAGGTTATGGACCAAAAGAAACCATAAACCAAATTTTAAAACCCGCTAACCATGGCGGGTTTTTTT
Vibrio salmonicida LFI1238
VSAL_I0377 leuA -174 40.3 ATGAAAACAGCATCTTCTTTACTTCTAAACCTCCTCCTTATCGTGAACATCTCACGCGGGTAGGTTGTGGAATAAAAGAAGCCATAAACCAAATTTTAAAACCCGCTGAACATGGCGGGTTTTTTT
Vibrio angustum S14
VAS14_08170 leuA -188 36.3 AAAAAACGTTTCTCTTTACTCCTTAGCCTCCTCCTTATCGTGACTTAAATCGCGCGGGTTGCTTTTGAGTGGGAAACGCCACTAAAGATTTTAAAACCCGCGCAACTTGCGCGGGTTTTTTCAT
Photobacterium profundum SS9
PBPRA0419 leuA -201 34.4 AAAAAATGAAAAATCGTTTCTCTTTACTCTTAAGCCTCCTCCTTATCGTGAATAATTCGCGCGGGTAGCTTATAGGTGAGAAACACCACATAAGAATCTAAAAACCCGCGCAGTCTGCGCGGGTTTTTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD