Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator L10_leader in Vibrionales

Properties
Regulator family: RF00557
Regulation mode:
Biological process: Ribosome biogenesis
Effector:
Regulog: L10_leader - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio splendidus LGP32
VS_2965 rplJ -139 25.3 AGCAATTCAGGTCATCCGTCCCAAGACCGTAGGCGCCGTACTCTTCGGAGATATGGCTTAATAAAACCTACGTAGGCGATGTTGTGGTTTGAAGTGAATTTATTCGTTTTTAAATAACATC
Vibrio fischeri ES114
VF_2416 rplJ -288 24.2 TTTAATTAGGAAGTCTCCGTCCAAGACCGTAGGCGCTCGAAAGAGCTTAATAAAACCTGCGTAGACGGTGCCCGAACTTGAAATCAATTTTGTAAAAATTGGTTTTTTGTGACTGCA
Vibrio salmonicida LFI1238
VSAL_I2868 rplJ -178 20.5 TTTGATTAAATAGTCTCCGTCCAAGACCGTAGGCGCTCGAAAGGGCTTAATAAAACCTGCGTAGACGGTGCCGAACTAAAGGCTAATTTTTCGAAATTAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD