Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FMN in Vibrionales

Properties
Regulator family: RF00050
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: FMN - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VCA1060 ribB -254 112 ACAATATTCTCAGGGCGGGGCGAAATTCCCCACCGGTGGTATGCCGCAAGGCGAGCCCACGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGAGAAGCCAGGGCCGACGGTTACAGTCCGGATGAGAGAGAATGACA
Vibrio vulnificus CMCP6
VV21426 ribB -238 125.3 TTTTTATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATACCGAATGAGGTGAGCCCGCGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGAGAGGCCAGAGCCGACGGTTATAGTCCGGATGAGAGAGAATGAAA
Vibrio harveyi ATCC BAA-1116
VIBHAR_05311 ribB -315 124.3 TCAATGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATACTCTTTTGAGTGAGCCCGCGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTTATAGTCCGGATGAAAGAGAATAAGA
Vibrio parahaemolyticus RIMD 2210633
VPA1250 ribB -253 128 ATTGTTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATACTTTTTCAAGTGAGCCCGCGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTTATAGTCCGGATGAAAGAGAATAAGAAT
Vibrio shilonii AK1
VSAK1_11965 ribB -343 131.4 TTTATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTAAATCAATGTTTGATAAGCCCGCGAGCGCTTAACTTTATGGAGTTAAGGTCAGCAGATCTGGTGAGAATCCAGAGCCGACGGTTAAAGTCCGGATGGGAGAGGATAATGAT
Vibrio splendidus LGP32
VS_II1263 ribB -497 121.8 TTTATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATGTTTTTAGCAAAATCTAAAGATAAGCCCGCGAGCGCTCGATTCGTCGAGGTCAGCAGATCTGGTGAGATGCCAGAGCCGACGGTCATAGTCCGGATGAGAGAGAATGAAAAC
Vibrio angustum S14
VAS14_06598 ribB -164 124.2 TATTAATTCTCAGGGCGGGGCGAAATTCCCCACCGGCGGTATACTTTTCAAGTGAGCCCGCGAGCGCTCGATATTTTCGAGGTCAGCAGATCTGGTTAGAAGCCAGAGCCGACGGTTATAGTCCGGATGAGAGAGAATTGAG
Photobacterium profundum SS9
PBPRB0898 ribB -330 99.5 TCTGAATTCTCAGGGCGGGGCGCAATTCCCCACCGGCGGTAATTCAGAGCACTCAATAGTGAGTTAACTGAAAAGCCCGCGAGCGCTTATCTTTTTTATAATGATAAGGTCAGCAGATCTGGTGTAATACTTCCTGTCAGTATGAGTCCAGAGCCGACGGTTATAGTCCGGATGAAAGAGGATCAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD